ID: 1043197560

View in Genome Browser
Species Human (GRCh38)
Location 8:77316916-77316938
Sequence GTCCAACGGTGTTTCAGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043197557_1043197560 7 Left 1043197557 8:77316886-77316908 CCATATTGTGCTTGTCCTCTTGA No data
Right 1043197560 8:77316916-77316938 GTCCAACGGTGTTTCAGTCAAGG No data
1043197558_1043197560 -8 Left 1043197558 8:77316901-77316923 CCTCTTGATTTCTTTGTCCAACG No data
Right 1043197560 8:77316916-77316938 GTCCAACGGTGTTTCAGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043197560 Original CRISPR GTCCAACGGTGTTTCAGTCA AGG Intergenic
No off target data available for this crispr