ID: 1043204556

View in Genome Browser
Species Human (GRCh38)
Location 8:77420626-77420648
Sequence CATTCCTAGCAGCTGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043204552_1043204556 19 Left 1043204552 8:77420584-77420606 CCAGTGAGGGGTCTCAAATGGGA No data
Right 1043204556 8:77420626-77420648 CATTCCTAGCAGCTGGAGGATGG No data
1043204550_1043204556 20 Left 1043204550 8:77420583-77420605 CCCAGTGAGGGGTCTCAAATGGG No data
Right 1043204556 8:77420626-77420648 CATTCCTAGCAGCTGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043204556 Original CRISPR CATTCCTAGCAGCTGGAGGA TGG Intergenic
No off target data available for this crispr