ID: 1043214885

View in Genome Browser
Species Human (GRCh38)
Location 8:77573652-77573674
Sequence AAGGAGAGCAAAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043214872_1043214885 30 Left 1043214872 8:77573599-77573621 CCTCCATCCCCTGGCAGCAGCCA No data
Right 1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG No data
1043214874_1043214885 23 Left 1043214874 8:77573606-77573628 CCCCTGGCAGCAGCCATGTAGCA No data
Right 1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG No data
1043214875_1043214885 22 Left 1043214875 8:77573607-77573629 CCCTGGCAGCAGCCATGTAGCAT No data
Right 1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG No data
1043214876_1043214885 21 Left 1043214876 8:77573608-77573630 CCTGGCAGCAGCCATGTAGCATG No data
Right 1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG No data
1043214873_1043214885 27 Left 1043214873 8:77573602-77573624 CCATCCCCTGGCAGCAGCCATGT No data
Right 1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG No data
1043214878_1043214885 10 Left 1043214878 8:77573619-77573641 CCATGTAGCATGGAGAATCTGTG No data
Right 1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043214885 Original CRISPR AAGGAGAGCAAAGTGATTGT GGG Intergenic
No off target data available for this crispr