ID: 1043218085

View in Genome Browser
Species Human (GRCh38)
Location 8:77621080-77621102
Sequence CCTGTCATCCAGTGGGTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043218080_1043218085 10 Left 1043218080 8:77621047-77621069 CCAGCAGAAACGCGTGTTACAGC No data
Right 1043218085 8:77621080-77621102 CCTGTCATCCAGTGGGTGTTGGG No data
1043218078_1043218085 12 Left 1043218078 8:77621045-77621067 CCCCAGCAGAAACGCGTGTTACA No data
Right 1043218085 8:77621080-77621102 CCTGTCATCCAGTGGGTGTTGGG No data
1043218079_1043218085 11 Left 1043218079 8:77621046-77621068 CCCAGCAGAAACGCGTGTTACAG No data
Right 1043218085 8:77621080-77621102 CCTGTCATCCAGTGGGTGTTGGG No data
1043218077_1043218085 21 Left 1043218077 8:77621036-77621058 CCTGTTGCTCCCCAGCAGAAACG No data
Right 1043218085 8:77621080-77621102 CCTGTCATCCAGTGGGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043218085 Original CRISPR CCTGTCATCCAGTGGGTGTT GGG Intergenic
No off target data available for this crispr