ID: 1043221435

View in Genome Browser
Species Human (GRCh38)
Location 8:77670857-77670879
Sequence CTTGTCCAGTCTATCATTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043221435_1043221438 3 Left 1043221435 8:77670857-77670879 CCATTAATGATAGACTGGACAAG No data
Right 1043221438 8:77670883-77670905 AATATGGCACATACACACCATGG 0: 16
1: 1259
2: 22552
3: 13333
4: 10304
1043221435_1043221440 25 Left 1043221435 8:77670857-77670879 CCATTAATGATAGACTGGACAAG No data
Right 1043221440 8:77670905-77670927 GAATACTATGCAGCCATAAAAGG 0: 137
1: 172
2: 275
3: 516
4: 823

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043221435 Original CRISPR CTTGTCCAGTCTATCATTAA TGG (reversed) Intergenic
No off target data available for this crispr