ID: 1043221438

View in Genome Browser
Species Human (GRCh38)
Location 8:77670883-77670905
Sequence AATATGGCACATACACACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47464
Summary {0: 16, 1: 1259, 2: 22552, 3: 13333, 4: 10304}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043221432_1043221438 11 Left 1043221432 8:77670849-77670871 CCAAATGCCCATTAATGATAGAC 0: 117
1: 3698
2: 8419
3: 17419
4: 6107
Right 1043221438 8:77670883-77670905 AATATGGCACATACACACCATGG 0: 16
1: 1259
2: 22552
3: 13333
4: 10304
1043221435_1043221438 3 Left 1043221435 8:77670857-77670879 CCATTAATGATAGACTGGACAAG No data
Right 1043221438 8:77670883-77670905 AATATGGCACATACACACCATGG 0: 16
1: 1259
2: 22552
3: 13333
4: 10304
1043221434_1043221438 4 Left 1043221434 8:77670856-77670878 CCCATTAATGATAGACTGGACAA No data
Right 1043221438 8:77670883-77670905 AATATGGCACATACACACCATGG 0: 16
1: 1259
2: 22552
3: 13333
4: 10304
1043221431_1043221438 12 Left 1043221431 8:77670848-77670870 CCCAAATGCCCATTAATGATAGA 0: 143
1: 4438
2: 9901
3: 18639
4: 8785
Right 1043221438 8:77670883-77670905 AATATGGCACATACACACCATGG 0: 16
1: 1259
2: 22552
3: 13333
4: 10304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043221438 Original CRISPR AATATGGCACATACACACCA TGG Intergenic
Too many off-targets to display for this crispr