ID: 1043221440

View in Genome Browser
Species Human (GRCh38)
Location 8:77670905-77670927
Sequence GAATACTATGCAGCCATAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1923
Summary {0: 137, 1: 172, 2: 275, 3: 516, 4: 823}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043221434_1043221440 26 Left 1043221434 8:77670856-77670878 CCCATTAATGATAGACTGGACAA No data
Right 1043221440 8:77670905-77670927 GAATACTATGCAGCCATAAAAGG 0: 137
1: 172
2: 275
3: 516
4: 823
1043221435_1043221440 25 Left 1043221435 8:77670857-77670879 CCATTAATGATAGACTGGACAAG No data
Right 1043221440 8:77670905-77670927 GAATACTATGCAGCCATAAAAGG 0: 137
1: 172
2: 275
3: 516
4: 823

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043221440 Original CRISPR GAATACTATGCAGCCATAAA AGG Intergenic
900039753 1:449142-449164 GAATACTACTCAGCCTTAATAGG + Intergenic
900061185 1:684118-684140 GAATACTACTCAGCCTTAATAGG + Intergenic
900354772 1:2255189-2255211 GAAGACTATGCAGCAAGAATGGG - Intronic
902095795 1:13944173-13944195 GAATACTATTCAGCAACAAAAGG + Intergenic
903201177 1:21740301-21740323 GAATACTATTCAGGCTTAAATGG - Intronic
903570385 1:24300250-24300272 GAATATTATTCAGCGATAAAAGG - Intergenic
903748924 1:25607329-25607351 GAATATTATTCAGCCTTAAATGG + Intergenic
903840730 1:26237528-26237550 GAGTATTATTCAGCAATAAAAGG - Intronic
903902363 1:26657221-26657243 GAATATTATTCAGCCTTAAAAGG + Intergenic
903941226 1:26932922-26932944 GAATATTATTCAGCCTTAAAGGG - Intronic
904668539 1:32143918-32143940 GAATATCATTCAGCCAAAAAAGG - Intronic
904842304 1:33380514-33380536 GAATACTATTCAGCTATCAAAGG - Intronic
905074431 1:35257422-35257444 GAATATTACTCAGCCATAAAAGG + Intergenic
905317284 1:37091206-37091228 GAATATTATTCAGCACTAAAAGG - Intergenic
905331297 1:37200947-37200969 GAATACTATGAAGCCATAAAAGG + Intergenic
905710724 1:40100054-40100076 GCATACTACACAGCCAAAAAAGG - Intergenic
906094708 1:43214456-43214478 GAATACTACTCAGAAATAAAAGG - Intronic
906347680 1:45029777-45029799 GAATATTATTCAGCCATAAAAGG - Intronic
906465191 1:46072561-46072583 GACTATTATTCAGCCTTAAAAGG + Intronic
906549148 1:46647459-46647481 GAATAATATTCAGCAGTAAAAGG - Intronic
906578587 1:46914339-46914361 GAATACTATTCAGCCATAGAAGG - Intergenic
906757019 1:48327628-48327650 GAACACTATACAGCCATAAAAGG + Intronic
906954845 1:50365216-50365238 GAATACTATGCAGCCAAAAAGGG + Intergenic
907168690 1:52439922-52439944 GAATATTTTTCAGCCATAAAAGG + Intronic
907175587 1:52519176-52519198 CAATACTATTCGGCAATAAAAGG + Intronic
907232942 1:53017537-53017559 GAATATTATTGAGCAATAAAAGG - Intronic
907488407 1:54792930-54792952 GAATTCCTTGCAGCCATAAGAGG - Intronic
907793196 1:57688720-57688742 AAATACTATGCAGCCATAAAAGG + Intronic
908291926 1:62676183-62676205 GAATATTAGTCAGCCATAAAAGG + Intronic
908379264 1:63579399-63579421 AAATACTACTCAGCAATAAAGGG - Intronic
908443724 1:64181695-64181717 GAATACTATCCACCTATATATGG + Intergenic
908529848 1:65023952-65023974 GAATACTACTCAGCAATAAAAGG - Intergenic
908533430 1:65055339-65055361 GAATATGATTCAGCCTTAAAAGG - Intergenic
908699602 1:66884167-66884189 GAATACTATTCAGCCTTAAAAGG - Intronic
908776747 1:67647988-67648010 GAATATTATTCAGCCTTAAAAGG + Intergenic
908879459 1:68714433-68714455 GAATACTATTCGGCCATAAAAGG + Intergenic
909068750 1:70966785-70966807 GAATACTATGCAGTCATAAAAGG - Intronic
909217518 1:72909350-72909372 GAATACTATGCAGCCACAGAAGG - Intergenic
909243823 1:73251203-73251225 GAATATTATTCAGCCATAAAAGG - Intergenic
909285498 1:73811618-73811640 GAATACTATGCAGCCATAAAAGG + Intergenic
909383684 1:75032159-75032181 GAATATTATTCAGCAACAAAAGG + Intergenic
909582812 1:77257000-77257022 GAATATCATGCAGCCATAAAAGG - Intergenic
909594221 1:77387029-77387051 GAATTCTATTCAGCCATAAAAGG - Intronic
909721184 1:78771516-78771538 GAATACTACTCAGCCATAAAAGG - Intergenic
909806676 1:79881379-79881401 GCAAACTATGCATCCAAAAAAGG + Intergenic
909878659 1:80844900-80844922 GAATATTACGCAGCCATAAAAGG - Intergenic
909898531 1:81104734-81104756 GAATACGATACAGCCATAAAAGG - Intergenic
909947842 1:81683628-81683650 GAATACTACGCAGCCATAAAAGG - Intronic
910775321 1:90868951-90868973 GAATATTATTCAGCCTTCAAAGG - Intergenic
910810265 1:91228441-91228463 AAATACTATGCCACCATAAAAGG - Intergenic
910885612 1:91960345-91960367 GAATATTATTTAGCCTTAAAAGG + Intronic
911189155 1:94930524-94930546 GAATACTACTCAGTAATAAAAGG - Intergenic
911265438 1:95737539-95737561 GAATACTACTCAGCCATTAAAGG - Intergenic
911765811 1:101673214-101673236 GGATATTATTCAGCCTTAAAAGG - Intergenic
911828246 1:102515470-102515492 GAATATTATACAGCCATAAAAGG + Intergenic
911845140 1:102743677-102743699 AAATACTATTCAGCAATAAAAGG + Intergenic
911958798 1:104272029-104272051 GAATACTATGCAACCATAAAAGG - Intergenic
912025734 1:105168974-105168996 GATTACTACTCAGCCATAAAAGG + Intergenic
912062923 1:105696544-105696566 GAATATTATGCAGCCAAAGAAGG - Intergenic
912098453 1:106174853-106174875 GAATACTATACAGCCATAAAAGG + Intergenic
912284480 1:108354500-108354522 GAATGCTACTCAGCCATAAAAGG + Intergenic
912433538 1:109642704-109642726 AAATATCATTCAGCCATAAAAGG + Intergenic
912663438 1:111556554-111556576 AAATATTATCCAGCCTTAAAAGG + Intronic
912693517 1:111822546-111822568 GAATATTATTCAGCCTAAAAAGG - Intronic
912819104 1:112852932-112852954 ATATATTATGCAGCTATAAAAGG + Intergenic
912820032 1:112859789-112859811 GATTATTATTCAGCCATAAAAGG - Intergenic
912929393 1:113943468-113943490 GAATATTATACAGCCATAAAAGG - Intronic
913248446 1:116891077-116891099 GAATATTATTCAGCCTTAAAAGG - Intergenic
913464185 1:119122692-119122714 GAATACTACTCAGCCATAAAAGG + Intronic
913474291 1:119222028-119222050 GAATATTATTCAGCCATAAAAGG - Intergenic
913541419 1:119824754-119824776 GAATATTATTCAGCCTTAAAAGG + Intergenic
914215360 1:145622224-145622246 GAATATTGTTCAACCATAAAAGG + Intronic
914439930 1:147696017-147696039 GAATATTATTCTGCCTTAAAAGG - Intergenic
914467310 1:147942609-147942631 GAATATTGTTCAACCATAAAAGG + Intronic
914749068 1:150520502-150520524 GAATATGATTCAGCCATAAAAGG - Intergenic
915382030 1:155450853-155450875 GAATATTATTCAGCCTTAAAAGG + Intronic
915785107 1:158602417-158602439 AAATAATATTCAGGCATAAATGG + Intergenic
915922361 1:159986080-159986102 GAATATTATTCAGCCTTAAAAGG + Intergenic
915978265 1:160404754-160404776 GAATAATATTCAGCTATAAAAGG - Intronic
916217116 1:162406367-162406389 AAATACTAAGCAGTCATAAGGGG + Intronic
916581098 1:166109924-166109946 GAATACTATGCAGACATAAAAGG + Intronic
916705754 1:167347871-167347893 GAATACCATTCAGCCATAAAAGG - Intronic
917389903 1:174523971-174523993 GAAGACTACTCAGCCATAAAAGG - Intronic
917947074 1:179985336-179985358 GAATATTATTCAGCCTTAAAAGG - Intronic
917950653 1:180030000-180030022 GAATATTATTCAGCCTTAAAAGG - Intronic
918061428 1:181064680-181064702 GCATAGTAAGCACCCATAAATGG - Intergenic
918076967 1:181177836-181177858 GAATGCTCTTCAGCCATAGATGG + Intergenic
918196373 1:182226048-182226070 GAATATTATTCAGCCATAAAAGG - Intergenic
918374020 1:183890615-183890637 GAATATTTTGCAGGCATAAAAGG + Intronic
918452892 1:184676713-184676735 GAACATAATTCAGCCATAAAAGG + Intergenic
918782426 1:188718336-188718358 GAATACTACTCAGCCATAAAAGG - Intergenic
918791204 1:188832426-188832448 GAATACTATTCAGAAATAACAGG + Intergenic
919076847 1:192823808-192823830 GAATACTAGTCAGCAGTAAAAGG - Intergenic
919111507 1:193225219-193225241 GAATACTACTCAGCCATAAAAGG - Intronic
919119243 1:193318177-193318199 GAATACTATGCAGCCATAAAAGG - Intergenic
919182065 1:194098867-194098889 GAATACAATGCAGTAATTAAAGG - Intergenic
919221079 1:194629508-194629530 AAATACTATGCAGCCATACAAGG + Intergenic
919268112 1:195300465-195300487 GAATAATATGAAGATATAAAAGG + Intergenic
919301183 1:195768374-195768396 GAATATTATACAACCATAAAAGG - Intergenic
919303530 1:195800774-195800796 GAATACTACACTGCAATAAAAGG + Intergenic
919571392 1:199253256-199253278 GAATGCTACTCAGCCATAAAAGG - Intergenic
920245824 1:204586643-204586665 GAATATTATTCAGCGCTAAAAGG - Intergenic
920499122 1:206475225-206475247 GAATATTATTCAGTCTTAAAAGG + Intronic
920828735 1:209446773-209446795 GAATACTATGCAGTCATAAAAGG + Intergenic
920909967 1:210207224-210207246 GAATACTATTCAGCAATTAAAGG + Intergenic
921106586 1:211986893-211986915 ATATACTATGCGGCCATAAAAGG + Intronic
921111908 1:212046626-212046648 GAATACAATGCAGCCATAAGAGG - Intronic
921248658 1:213275144-213275166 GAATATTATTCAGCCTTAAAAGG - Intergenic
921300096 1:213743933-213743955 GAATACTACTCAGCCATAAAAGG + Intergenic
921760115 1:218903504-218903526 GAATACTATGCAGCCATAAAAGG + Intergenic
921810788 1:219511406-219511428 GAATACTACTCACCAATAAAGGG + Intergenic
921923467 1:220692444-220692466 GAATAGTATTCAGCCATAAAAGG + Intronic
921950456 1:220924329-220924351 GAAAACTATGCATCCAACAAAGG - Intergenic
921967819 1:221110172-221110194 AAATACTACTCAGCAATAAAAGG - Intergenic
922145964 1:222944819-222944841 GATTACTACTCAGCAATAAATGG - Intronic
922229052 1:223669818-223669840 GAATATTATTCAGCCATAAAAGG + Intergenic
922493590 1:226038664-226038686 GAATACTACTCAGCAATAAAAGG - Intergenic
922743948 1:228032536-228032558 GAATATTACTCAGCCATAAAAGG - Intronic
922976588 1:229789657-229789679 GAATACTATGTAGCCATAAAAGG + Intergenic
923104238 1:230842397-230842419 GAATACTACTCAGCCAAAAAAGG + Intronic
923625351 1:235609201-235609223 GAATACTCTTCAGCCATAAAAGG - Intronic
923732850 1:236569932-236569954 CAATATTATTCAGTCATAAAAGG + Intronic
923769189 1:236922582-236922604 GAATACTATTCAGCAGTAAAAGG + Intergenic
923828249 1:237524208-237524230 GCATATTATTCAGCAATAAAAGG + Intronic
923940723 1:238822715-238822737 GAATATTATTCAGCACTAAAAGG + Intergenic
924036141 1:239940504-239940526 GACTACTACCCAGCAATAAAAGG + Intergenic
924055918 1:240124009-240124031 GAATATGATTCAGCCTTAAAAGG - Intronic
924286079 1:242488371-242488393 GAATATTATTCAGCACTAAAAGG + Intronic
924333037 1:242959322-242959344 GAATACTATGTGGCTAAAAAAGG - Intergenic
924496109 1:244590775-244590797 GAATATTACTCAGCCGTAAAAGG - Intronic
924546895 1:245036643-245036665 GAATATTGTTCAGCTATAAAAGG + Intronic
924689601 1:246333490-246333512 GCAAACTATGCAGCCAACAAAGG + Intronic
924751485 1:246896363-246896385 GAATATTATACAGCCATAAAAGG + Intronic
924838705 1:247683825-247683847 GAATACCATTCAGCCATTAAAGG - Intergenic
1063168957 10:3488899-3488921 GAATACTATTCAGCCATAAAAGG + Intergenic
1063207075 10:3842894-3842916 GACTCGTATTCAGCCATAAATGG - Intergenic
1064165845 10:12985580-12985602 GAATACTACCCAGCAATGAAAGG + Intronic
1064433106 10:15288100-15288122 GAATACTTATCAGCCATGAAAGG - Intronic
1064510999 10:16091363-16091385 TAATACTACACAGCCATAAAGGG + Intergenic
1064654660 10:17545323-17545345 GAATATTATTCAACCTTAAAAGG + Intergenic
1064816761 10:19274277-19274299 GAATATCATGCAGCCTTAAGGGG + Intronic
1064944999 10:20777705-20777727 GAAAACTATGAAGCCAGGAATGG + Intergenic
1065018618 10:21484017-21484039 GAAAACTAATCAGCCTTAAAAGG + Intergenic
1065272662 10:24051258-24051280 GAATACTACTCAGCCATAAAAGG - Intronic
1065462888 10:25988006-25988028 GAATACTACTCAGCCATAAAAGG + Intronic
1065509150 10:26460605-26460627 GAATACTATGCAGCCATAAAAGG + Intronic
1065793772 10:29286297-29286319 GAATACTACTCAGCAATGAAAGG - Intergenic
1065948824 10:30632894-30632916 GAATACTACTCAGCAATGAAAGG + Intergenic
1066191784 10:33062606-33062628 GAATATTATTTAGCCATAAAAGG + Intergenic
1066423301 10:35281738-35281760 GAATAGTATTCAGCCATAAAAGG + Intronic
1066513107 10:36123456-36123478 GAATACTACTCAGCCATAAAAGG - Intergenic
1066535546 10:36387032-36387054 GAATACTATTCAGCCTGAAAAGG + Intergenic
1066643188 10:37577194-37577216 GAATACTATTCAGCCTGAAAAGG + Intergenic
1066753907 10:38690188-38690210 AAATTCTATACAGCCAGAAAGGG - Intergenic
1066754642 10:38698811-38698833 GAATTCTATGAAGCTATTAAGGG + Intergenic
1067024772 10:42835216-42835238 GAATATTATTCAGCCTTAAAAGG - Intergenic
1067241900 10:44504436-44504458 AAATACTACTCAGCCATAAAAGG + Intergenic
1067264473 10:44725816-44725838 GAATGTTATTCAGCCATACAAGG - Intergenic
1067437722 10:46289990-46290012 AAATATTATTCAGCCATAAAAGG - Intronic
1067520497 10:46998279-46998301 GAATATTATTTAGCAATAAAAGG + Intronic
1067813262 10:49447877-49447899 GAATATTACTCAGCCACAAAAGG - Intergenic
1068002414 10:51351094-51351116 GAATACTATGCAGCCATAAAAGG - Intronic
1068027254 10:51661884-51661906 GAATACTATGCAGTCATAAAAGG + Intronic
1068265763 10:54647141-54647163 GAATAGTATTCAGTCTTAAAGGG + Intronic
1068274277 10:54772920-54772942 GAATACTATGCAGCATAAAAAGG + Intronic
1068288797 10:54974714-54974736 GAATTCTGAGCAGCCATCAAGGG + Intronic
1068493077 10:57748599-57748621 GAATACTATACAACCATAAAAGG - Intergenic
1068556434 10:58464299-58464321 GAATACTACTCATCCATAAAAGG - Intergenic
1069113373 10:64474208-64474230 AAATACTACTCAGCCATAAAAGG + Intergenic
1069128072 10:64662899-64662921 AAATATTATTCAGCCATAAAAGG - Intergenic
1069171784 10:65240234-65240256 GAATATGATTCAGCCTTAAAAGG + Intergenic
1070001754 10:72383538-72383560 GAATACTATGCAGCTATTGAAGG - Intronic
1070049140 10:72869862-72869884 GAATATTATGCAACTATTAAAGG + Intronic
1070518506 10:77230094-77230116 GAATATTATTCAGCCATCAAAGG + Intronic
1070723394 10:78772162-78772184 GAATACTTTGCATCCAGAGAGGG + Intergenic
1071059573 10:81553923-81553945 GAATATTATGCAGCTATAAAAGG + Intergenic
1071133447 10:82423977-82423999 GAATATTATTCACTCATAAAAGG - Intronic
1071669269 10:87592420-87592442 GAGTATTATTCAGCCATAAAAGG + Intergenic
1071706113 10:88000764-88000786 GAATACTATGCAGCCATAAAAGG + Intergenic
1071919492 10:90333278-90333300 GAATACTCTTCAGCCATAAAAGG - Intergenic
1072360993 10:94659049-94659071 GAATACTATGCAGCCATAAAAGG - Intergenic
1072493164 10:95928741-95928763 GAATACTATGGAGACAAAAAAGG - Intronic
1072823642 10:98583840-98583862 GAATATTATTTAGCAATAAAAGG - Intronic
1072835354 10:98705561-98705583 GAATAATACGCAGCCTTAAAAGG + Intronic
1072854277 10:98930321-98930343 AAATACTATGCAGCCATAAAAGG - Intronic
1072999123 10:100272909-100272931 GAATATTGTTCAGCCATAAAAGG + Intergenic
1073031748 10:100531699-100531721 GAATATTATACAGCCCAAAAAGG - Intronic
1073432992 10:103498874-103498896 GAATATTATTCAACCACAAAAGG - Intronic
1073718126 10:106132335-106132357 GTATACTGTGTAGCCATAACTGG + Intergenic
1073923327 10:108483725-108483747 GAATGCTACTCAGCCAAAAAAGG - Intergenic
1074003863 10:109399268-109399290 GAATACTATGCAACCAAAAAAGG + Intergenic
1074261525 10:111858232-111858254 GAATACTATGCAGCCATAAAGGG - Intergenic
1074393535 10:113078047-113078069 AAATATTATTCAGCCATAAAAGG - Intronic
1074537424 10:114338589-114338611 GAATACTACTCAGCAATAAAAGG + Intronic
1074557599 10:114506198-114506220 GAATACTACACAGCCAAAAACGG - Intronic
1074684179 10:115943832-115943854 GAATATAATTCAGCAATAAAAGG + Intronic
1074731432 10:116380740-116380762 GAATACTACTCAGCCTAAAAAGG + Intergenic
1075050623 10:119180721-119180743 GAATATTATTTATCCATAAAAGG + Intergenic
1075113398 10:119606204-119606226 GAATAGTATTCAGCTATTAAGGG + Intergenic
1075178972 10:120192868-120192890 GAATATTATTCAGCTATTAAAGG - Intergenic
1076557594 10:131338005-131338027 GAACATTATTCAGCCTTAAAAGG - Intergenic
1076588143 10:131564012-131564034 GAATAGTATGCAGCCTTAAAAGG + Intergenic
1076965976 11:85055-85077 GAATACTACTCAGCCTTAATAGG + Intergenic
1077660260 11:4061787-4061809 GAATATTATTCACCTATAAATGG + Intronic
1077709401 11:4520789-4520811 GAATACTATGCACCCATAAAAGG - Intergenic
1077751420 11:4974760-4974782 GAATATTATACAGCCATAAAAGG + Intronic
1077860732 11:6176965-6176987 GAATATTATTCAGCTTTAAAAGG + Intergenic
1078058298 11:8025665-8025687 GAATACTACTCAGCAATAAAAGG - Intronic
1078126957 11:8575407-8575429 GACTATTATCCAGCCACAAAAGG + Intronic
1078198652 11:9159186-9159208 GAATATTATTGAGCAATAAAGGG - Intronic
1078340346 11:10494134-10494156 GAATATCATTCAGCCATAAAAGG + Intronic
1078401672 11:11033876-11033898 GAATACTACTCAACCATAAAAGG + Intergenic
1078797273 11:14604887-14604909 GAATACTACACAGCCATAAAAGG - Intronic
1078831800 11:14984501-14984523 GAAGGCTATTCAGCCTTAAAAGG - Intronic
1078948756 11:16103679-16103701 GAATACTACTCAGCCATAAAAGG + Intronic
1079047297 11:17116983-17117005 GAATATTATTCAACCAAAAATGG + Intronic
1079482532 11:20896320-20896342 AAATACTACTCAGCCATAAAAGG - Intronic
1079587601 11:22145196-22145218 AAATACTGTGCATCCATAAAAGG - Intergenic
1079621659 11:22562922-22562944 GAATGATATGCAGCCATAAAAGG - Intergenic
1079893142 11:26083480-26083502 GAATACTATGCAGCCATAAAAGG + Intergenic
1080019230 11:27542559-27542581 GAATACTACTCAGCAATAAAAGG + Intergenic
1080021706 11:27568346-27568368 GAATACTACTCAGCCCAAAAAGG + Intergenic
1080023410 11:27588337-27588359 GAATACTATACAGTCATAAAAGG - Intergenic
1080024385 11:27598407-27598429 AAATATTATTCAGCCTTAAAAGG - Intergenic
1080246756 11:30187895-30187917 GAATATTACCCAGCCATAAAAGG - Intergenic
1080423372 11:32133379-32133401 GAATACTACTCAGTCATAAAAGG - Intergenic
1080534835 11:33211591-33211613 GAATACTCTTCAGCCTTAAAAGG + Intergenic
1080557891 11:33433744-33433766 GAATACTATGCAGCCATAAAAGG + Intergenic
1081009120 11:37785893-37785915 GAATACTATACAGCCATAAAAGG + Intergenic
1081009330 11:37788724-37788746 GAATACTACTCAGCCACATAAGG - Intergenic
1081024792 11:37998039-37998061 GAATACCATTTAGCCATGAAAGG + Intergenic
1081042408 11:38227542-38227564 CAATACTCTTCAGCAATAAAAGG + Intergenic
1081115582 11:39194656-39194678 GGATACTATAAAGCCATAAAGGG - Intergenic
1081180441 11:39979744-39979766 GAATACTATTCAGCCATAAAAGG - Intergenic
1081304191 11:41491591-41491613 GAATACTATTTAGCCATAAAAGG + Intergenic
1081504084 11:43696817-43696839 GAATACTATGCAACCAAAAAAGG + Intronic
1081648960 11:44810462-44810484 GAATATTATTCAGCCACAAAAGG - Intronic
1082057467 11:47831477-47831499 GAAAATTATTCAGCTATAAAAGG + Intronic
1082098541 11:48151781-48151803 GAATACTATGCAGCCATAAAAGG - Intronic
1082135995 11:48549828-48549850 GAATACTATACAGCATAAAAAGG - Intergenic
1082250143 11:49969270-49969292 GCATACTATGCAGCCATAAAAGG + Intergenic
1082263146 11:50092867-50092889 GAATATTATTCGGCCATAGAAGG + Intergenic
1082569196 11:54717080-54717102 GAATACTATGCAGCCATTAAAGG + Intergenic
1082697294 11:56384981-56385003 GCAAACTATGCATCCATCAAAGG + Intergenic
1082919427 11:58476741-58476763 GAATATTATTCAGCCATAAAAGG + Intergenic
1082920780 11:58491132-58491154 GAATACTATTCAACCTTAAGAGG + Intergenic
1083015147 11:59445345-59445367 GAATACTATGCAGCCATAAAAGG - Intergenic
1083345795 11:61991066-61991088 GAATACTATGGAGCCATAAAAGG + Intergenic
1083819829 11:65163019-65163041 GAATATTGTTCACCCATAAAAGG - Intergenic
1084081728 11:66831403-66831425 GAACACTATGTGGCAATAAAAGG + Intronic
1084668098 11:70587449-70587471 GCATTCTACGCAGCCATCAAAGG + Intronic
1085195350 11:74668377-74668399 GAATACTGTCCAGCCCTAAAAGG + Intronic
1085563727 11:77494273-77494295 GAATACTATGCAGGCATTAAAGG + Intergenic
1085599181 11:77839624-77839646 GTATACTATGCAACCATAAAGGG + Intronic
1085664468 11:78401483-78401505 GAATACTGTTCAGCCTTAAAAGG - Intronic
1085664475 11:78401624-78401646 GAATACTGTTCAGCCTTAAAAGG - Intronic
1085836153 11:79958874-79958896 GAATACTATTCAACAATAACAGG - Intergenic
1086315232 11:85584313-85584335 GAATACTACTCAGCCATAAAAGG - Intronic
1086398101 11:86437242-86437264 GAATACTATTCAGCCATAAAAGG - Intergenic
1086474924 11:87162556-87162578 GAATACTATGCAGCCATAAAAGG - Intronic
1086570170 11:88274551-88274573 GAATATTACGCAGCAATAAAAGG + Intergenic
1086667887 11:89506949-89506971 CAATACTATTCACCAATAAAAGG + Intergenic
1086735034 11:90295662-90295684 GACTATTATTCAGCCTTAAAAGG + Intergenic
1086836728 11:91633633-91633655 GAATACTACTCTGCAATAAAAGG + Intergenic
1086929678 11:92679136-92679158 GAATACTATTCAGCCATAAAAGG - Intronic
1086985551 11:93245017-93245039 GAATAGTATTCAGCCTTAAAAGG - Intergenic
1086994909 11:93345194-93345216 AAATACTATGCAGCCATAAAAGG - Intronic
1087053849 11:93912309-93912331 AAATATTATTCAGCAATAAAAGG - Intergenic
1087068279 11:94048169-94048191 GAATAGTATTCAGCCTTAAAAGG - Intronic
1087136532 11:94726392-94726414 GAATACTATGAATACATAATTGG - Intronic
1087219258 11:95528274-95528296 GAATACTACTAAGACATAAAAGG - Intergenic
1087236248 11:95722013-95722035 GAATACTATTCAGTGATAAAGGG + Intergenic
1087355414 11:97087537-97087559 GAATATTCTGAAGCCATTAATGG - Intergenic
1087427214 11:98005819-98005841 GAATATAATTTAGCCATAAAAGG - Intergenic
1087437076 11:98134821-98134843 GAGTACTATACAACAATAAAAGG - Intergenic
1087590584 11:100183404-100183426 GAATACTACTCAGCAATAAAAGG + Intronic
1087629511 11:100634140-100634162 GAATGTTATTCAGCCATAAAAGG - Intergenic
1087694842 11:101364814-101364836 GAATATTATGCAGCCATAAAAGG - Intergenic
1087910264 11:103744348-103744370 AAATACTACGCAGGCATAAAAGG - Intergenic
1087955478 11:104281591-104281613 GAATACTATTCAGCAATAAAGGG - Intergenic
1088010872 11:104999389-104999411 GAATACTGTGTAGCCCTAAAAGG - Intronic
1088014986 11:105047548-105047570 AAATACTATTCAGTCATAAAAGG + Intronic
1088033870 11:105287652-105287674 AAATATTATTCAGCCATGAAAGG + Intergenic
1088077785 11:105873258-105873280 GAATATTATGCAGCCATAAAAGG - Intronic
1088131243 11:106494022-106494044 GAATTCTACTCAGCCATCAAAGG + Intergenic
1088150790 11:106742526-106742548 GAATACTATGCAGCCATAAAGGG - Intronic
1088498001 11:110451738-110451760 GAATACTGTGCAGCCGTAGAAGG + Intronic
1088534598 11:110846686-110846708 GAATACTATGCAGCCATAAAAGG - Intergenic
1088982136 11:114873430-114873452 GAATACTATTCAGCCTTAAAAGG + Intergenic
1089295707 11:117466249-117466271 GGATAGTATGCAGCCATGAAAGG + Intronic
1089764699 11:120754431-120754453 GAATATTATTCAGCCATGAAAGG - Intronic
1089943701 11:122445285-122445307 GAATACTACTCAGCCATAAAAGG - Intergenic
1090009242 11:123031537-123031559 GAATACTCTGAAGCTGTAAAAGG + Intergenic
1090288243 11:125518916-125518938 GAATATTATTCAGCCAGAAAAGG + Intergenic
1090677171 11:129009672-129009694 GAATACTATGCAGCCATAAAAGG - Intronic
1090732291 11:129582253-129582275 GAATATTATTCAGCCATTAAAGG - Intergenic
1090826839 11:130393341-130393363 AAATACTATGCAGCCATGGCTGG - Intergenic
1090981874 11:131729757-131729779 AAATATTATTCAGCCATAAAAGG - Intronic
1091049565 11:132355194-132355216 GGATACAATGCAGTCATAAAGGG - Intergenic
1091340331 11:134807118-134807140 GAATACCATTCAGCCATAAAAGG - Intergenic
1091480065 12:818809-818831 GAATGTTATTCAGTCATAAAAGG - Intronic
1091573019 12:1707111-1707133 GAATACTACTCAGCAATAAAAGG - Intronic
1091829148 12:3536852-3536874 GAACACTATGCGGCCATTAAAGG - Intronic
1091840836 12:3619470-3619492 GAATCCCCTGCTGCCATAAAAGG + Intronic
1091939648 12:4466909-4466931 GAATACTATTTGGCAATAAATGG + Intergenic
1092505356 12:9092908-9092930 GAATATTATTCAGCCTTAAGTGG + Intronic
1092506273 12:9103749-9103771 GAATATTATGCAGCCTGAGAAGG - Intronic
1092535674 12:9384719-9384741 GAATACTATTCGGCAATAAAAGG - Intergenic
1092951878 12:13511420-13511442 GAATATTATTCAGCCTTAAAAGG - Intergenic
1093002909 12:14018272-14018294 AAATACTAGTCAGCAATAAAAGG - Intergenic
1093043295 12:14410964-14410986 GAGTATCATTCAGCCATAAACGG - Intronic
1093079770 12:14796213-14796235 GAATACTATTCAGCAATAAAAGG - Intronic
1093128252 12:15356613-15356635 CTATACTATTCAGCCATTAAAGG - Intronic
1093183329 12:15991357-15991379 GCAAACTATGCATCCAAAAAAGG - Intronic
1093218942 12:16395754-16395776 GAATACTACTCAGCCATTAAAGG - Intronic
1093248318 12:16768049-16768071 GAATACTATACAGCCATAAAAGG + Intergenic
1093252092 12:16819324-16819346 GAATATTATCGAGCCATTAAAGG + Intergenic
1093408413 12:18834849-18834871 GAATACTATGCAGCCATAAAAGG + Intergenic
1093424072 12:19008528-19008550 GAATACTATTTAGCATTAAAAGG + Intergenic
1093895463 12:24570111-24570133 GAATAAAATGGAGCCACAAAAGG + Intergenic
1093992070 12:25601102-25601124 GAGTACTACTCAGCCATAAAAGG + Intronic
1094571857 12:31648175-31648197 GAATATTATTTAGCCACAAAAGG + Intronic
1094591287 12:31823402-31823424 GAATACTACTCAACCATAAAAGG - Intergenic
1095302815 12:40606553-40606575 GAATACTATTCGGCAATAAAAGG + Intergenic
1095390149 12:41696246-41696268 GAATATTATTTAGCCTTAAAAGG + Intergenic
1095416498 12:41982894-41982916 GAATATTATTCAGCAACAAAAGG - Intergenic
1095588016 12:43870105-43870127 TAATACTATGCAGCATAAAAAGG - Intronic
1095590306 12:43895834-43895856 GAAGACTATTGAGACATAAAAGG - Intronic
1095691791 12:45098068-45098090 GACTGTTATTCAGCCATAAAAGG - Intergenic
1095725706 12:45449981-45450003 GAATAATACTCAGCCATAAAAGG + Intergenic
1095760253 12:45824897-45824919 AAATACTATTCAGCCCTAAAAGG + Intronic
1095807819 12:46339892-46339914 GAATACTACTCAGCCATAAAAGG - Intergenic
1095887415 12:47203649-47203671 GAATACTATGCAGCCATAAAAGG - Intronic
1096042899 12:48534965-48534987 GCAAACTATGCAGCCAACAAAGG + Intergenic
1096052273 12:48621072-48621094 GAATACTATTCAGCCTTAAAAGG + Intergenic
1096279202 12:50237255-50237277 AAATACTGTGCAGCAACAAAAGG + Intronic
1096380060 12:51149077-51149099 GAATATTACTCAGCCATAAAAGG + Intronic
1096888126 12:54738261-54738283 GAATACTACTCAGCCATAAAAGG - Intergenic
1096916937 12:55043542-55043564 GAATAATATTCAGTCATAAAAGG + Intergenic
1096923730 12:55118576-55118598 GAATACTATGCAGCCATAAAAGG - Intergenic
1097089858 12:56496398-56496420 GAATACTATGAAGGAATAAAAGG - Intergenic
1097152929 12:56993002-56993024 GAATATTACTCAGCCATGAAAGG + Intergenic
1097456197 12:59801742-59801764 GAATACTTTGTAGACATAAAAGG + Intergenic
1097600680 12:61688669-61688691 GACTACTACACAACCATAAAAGG - Intergenic
1097634691 12:62108322-62108344 GAATTCTATGCAGCCAAAAAAGG - Intronic
1097832021 12:64235385-64235407 GAATATTATTCAGCCTTAAAAGG + Intergenic
1097894342 12:64809434-64809456 GAATATTACTCAGCCATAAAAGG - Intronic
1097913297 12:64993927-64993949 GAATACTAAGCAGGCATAAAAGG + Intergenic
1098066349 12:66621443-66621465 GAATATTATTCAGCAATAAAAGG - Intronic
1098166001 12:67698661-67698683 GAATACTAAACAGCCAAGAATGG - Intergenic
1098189829 12:67936304-67936326 GAATAGTATTTATCCATAAAAGG + Intergenic
1098200807 12:68053480-68053502 GAATACTACTCAGCAATAAGGGG - Intergenic
1098207356 12:68125924-68125946 GAGTACTATTCAGCCATAAAAGG - Intergenic
1098243544 12:68492093-68492115 GAATATTATTCATCCATAAAAGG + Intergenic
1098300721 12:69051686-69051708 GAATACTACTCAGCCATAAAAGG + Intergenic
1098674563 12:73272648-73272670 GAATACTATACAGCCATAAAAGG + Intergenic
1098706121 12:73692162-73692184 GAATGCTATGCAGCCAAAAAAGG + Intergenic
1098734837 12:74087092-74087114 GAATACATTTCAGCCTTAAAAGG - Intergenic
1098742690 12:74194177-74194199 GAATACTATGCAGCCATTAAAGG - Intergenic
1098821870 12:75242287-75242309 CAATACTATACAGTAATAAAAGG + Intergenic
1098955563 12:76686237-76686259 GAAGAGTATGCAGTCAAAAAAGG + Intergenic
1098992638 12:77081066-77081088 GAATATTATTCCGTCATAAAAGG + Intergenic
1099038123 12:77615554-77615576 GGATACTATGCAACCATAAAAGG - Intergenic
1099293546 12:80802322-80802344 GAATACTATTCAGCCTTAAAAGG - Intronic
1099404541 12:82244358-82244380 GACTACTATGCAGCCATAAAAGG - Intronic
1099582526 12:84469044-84469066 GAATACCACTCAGCCATATAAGG - Intergenic
1099596733 12:84675852-84675874 GAATACTCTGCAGACTTAAAAGG - Intergenic
1099783452 12:87230255-87230277 GAAGTCTATACAACCATAAATGG + Intergenic
1099803414 12:87486835-87486857 GAATACTACACAACCATAAAAGG + Intergenic
1100328257 12:93562004-93562026 GAATACTATGCAGCCATAAAAGG + Intergenic
1100456720 12:94758773-94758795 AAATACTACTCAGCCATAAAAGG - Intergenic
1100486009 12:95028040-95028062 GAATATCATTCAGCCATAAAAGG - Intronic
1100748259 12:97669284-97669306 GGATATTATTCATCCATAAAAGG - Intergenic
1100923131 12:99512706-99512728 GAATACTATGCAGCCATAAAAGG + Intronic
1100928567 12:99579439-99579461 GCAAACTATGCATCCATCAAAGG + Intronic
1100951775 12:99858681-99858703 GAATACTACTCAGCAATAAAAGG + Intronic
1100966936 12:100023279-100023301 GAATACTACTTAGCCATAAAAGG + Intergenic
1100983505 12:100183504-100183526 GAATACTACTCAGCAATAAAAGG + Intergenic
1101534067 12:105601343-105601365 GCATACTAGAGAGCCATAAAAGG + Intergenic
1102123292 12:110460058-110460080 GAATACTACACAGCCATAAATGG + Intronic
1102365765 12:112333042-112333064 GAATTTTATTCAGCAATAAAAGG - Intronic
1102773365 12:115498021-115498043 GAATATTATTCAGTCTTAAAAGG - Intergenic
1102906309 12:116678067-116678089 GAACACTACACAGCCATAAAAGG - Intergenic
1102945937 12:116988037-116988059 GAATACCATGCAGTCCTAGAGGG - Intronic
1103276406 12:119715335-119715357 GAGTATTATTCAGCCATGAAAGG + Intronic
1103297609 12:119901503-119901525 GAATATTATTCAGTCATACATGG - Intergenic
1103482035 12:121256743-121256765 GAATATTATTCAGCCATTAAAGG - Intronic
1103595009 12:122019779-122019801 GAATATTATTCAGCCATAAAAGG - Exonic
1103702998 12:122857413-122857435 GAGTACGACTCAGCCATAAAAGG - Intronic
1104055120 12:125224126-125224148 AAATATTATCCAGCCATAAAAGG - Intronic
1104100506 12:125604251-125604273 GAATACTATGCAGCCATAAAAGG + Intronic
1104287508 12:127438197-127438219 GAATACTATTCAATAATAAAAGG - Intergenic
1104394918 12:128424373-128424395 ATATATTATTCAGCCATAAAAGG + Intronic
1105570094 13:21594683-21594705 CAATACTATGCAGCCATAAAAGG + Intronic
1105724661 13:23149964-23149986 GAATATTATTCAGCAATAAAAGG - Intergenic
1105835432 13:24207023-24207045 GAATACTATGCAGCCATAAAAGG + Intronic
1105908764 13:24840557-24840579 GACTACTACACAGCCATAAAAGG + Intronic
1106188717 13:27431441-27431463 GAATACTACACAGCCATAAAAGG + Intronic
1106278988 13:28245856-28245878 GAATATTATTCACCCATAAAAGG - Intronic
1106370173 13:29124735-29124757 GAAGACAATTCAGCCTTAAAAGG + Intronic
1106671815 13:31914291-31914313 GAATATTATTCAGCCTTAAAAGG + Intergenic
1106673995 13:31937748-31937770 GAATACTATTTAGCAATAAAAGG - Intergenic
1106816541 13:33414446-33414468 GAATACTATTCAGCTATAAAAGG + Intergenic
1106913732 13:34489665-34489687 GAATGTTATTCAGCCTTAAAAGG - Intergenic
1107233272 13:38137187-38137209 GGATACCATGCAGCCATAAAAGG - Intergenic
1107314283 13:39114333-39114355 GACTATTATGCAGCCAAAAAAGG - Intergenic
1107324237 13:39223924-39223946 GAATACTATGCAGCCATAAAAGG + Intergenic
1107334541 13:39340056-39340078 GAATACTACTCAGCAATAAAAGG - Intergenic
1107354286 13:39549822-39549844 GTATACTACTCAGCAATAAAAGG + Intronic
1107397857 13:40036527-40036549 GAGTACTACACAGCCATAAAAGG - Intergenic
1108034561 13:46275157-46275179 GAATACTATTCAGCTATAAAAGG - Intronic
1108049345 13:46415404-46415426 GAATACAATGCAGCCATAAAAGG + Intronic
1108156650 13:47592156-47592178 GAAAACTAGGCAAGCATAAAGGG + Intergenic
1108173454 13:47767865-47767887 GAATACTATGCAGCCATAACAGG - Intergenic
1108216834 13:48193737-48193759 GAATATTATTCAGCCTAAAAAGG - Intergenic
1108346111 13:49548609-49548631 GAATATTATTCAGTCATAAAAGG + Intronic
1108567317 13:51713492-51713514 GAATATTATTCAACCTTAAAAGG + Intronic
1108576023 13:51791931-51791953 GAATATCATTCAGCCTTAAAAGG - Intronic
1108599382 13:51978619-51978641 AATTACTGTACAGCCATAAATGG + Intronic
1108651365 13:52483171-52483193 GAATACTATGCAGCCATAAAAGG - Intergenic
1108667376 13:52646112-52646134 GAATACTGCTCAGCAATAAAAGG - Intergenic
1108800264 13:54086537-54086559 GAATACTATGAAGCCATAAAAGG - Intergenic
1108908588 13:55512481-55512503 GAATACTATGCAGCACTAAAGGG + Intergenic
1109268328 13:60226362-60226384 GATTACTTTGCACCCATAACTGG + Intergenic
1109335011 13:60982465-60982487 GAATATTATTCAGCAATTAAAGG + Intergenic
1109504494 13:63282576-63282598 GAATACTACTCAGTCATAAAAGG - Intergenic
1109533337 13:63683084-63683106 GAATACTATGCAGCCATAAAAGG - Intergenic
1109541865 13:63788683-63788705 GAATACAATGCAGCCATAACAGG + Intergenic
1109644467 13:65235338-65235360 GAAAACTATTCAGCTATAAAAGG - Intergenic
1109742447 13:66572548-66572570 GAATATTATTCAGCCATAAAAGG - Intronic
1109833414 13:67824096-67824118 GAATACTACTCAGCTTTAAAAGG - Intergenic
1109972875 13:69792688-69792710 GAATATTGTTCATCCATAAACGG + Intronic
1110010448 13:70326315-70326337 GAATACTATGCAGCCATAAAAGG - Intergenic
1110145316 13:72183413-72183435 GAGTACAATGCAGCCATAAAAGG - Intergenic
1110258779 13:73461512-73461534 GAATACTATGCAGCTATAAAAGG + Intergenic
1110454899 13:75680234-75680256 GAATACTGTGCAACCACAAAAGG - Intronic
1110505065 13:76276284-76276306 GAATACTACTCAGCCATAAAAGG + Intergenic
1110734523 13:78920316-78920338 GAATACTACACAGCCATAAAAGG - Intergenic
1110751066 13:79117071-79117093 TACTACTATTCAGCCATAAAAGG - Intergenic
1110795062 13:79627285-79627307 GAATATTATTCAGCCTTAAATGG + Intergenic
1110821335 13:79920541-79920563 GAATACTATGCAGCCATAAAAGG - Intergenic
1111310944 13:86484649-86484671 CAATATTATTCAGCCATAAAAGG + Intergenic
1111439816 13:88266431-88266453 GGATACTACTCAGACATAAAAGG - Intergenic
1111547732 13:89765192-89765214 TAATACTATTCAGCCTTAAATGG + Intergenic
1111659986 13:91197337-91197359 GAATGCTATTCAGCCTTAAAAGG - Intergenic
1111736504 13:92146845-92146867 GAATACTATTCAGCCATAAAGGG - Intronic
1111757792 13:92420828-92420850 GAGTGCTATTCAGCCATAAAAGG - Intronic
1112036719 13:95503644-95503666 GAATATTATTCAGCCTTAAAAGG + Intronic
1112088653 13:96057800-96057822 GAATATTATTCAGCCTTAAAAGG - Intergenic
1112250664 13:97776007-97776029 GAATACTACTTAGCCATAAAAGG - Intergenic
1112386966 13:98948888-98948910 GAATATTATTCAGCCTGAAAAGG - Intronic
1112417982 13:99219902-99219924 GAATATTATTCAGTCATAAGAGG - Intronic
1112575106 13:100628332-100628354 GAATATTATTCAGCCACAAAAGG - Intronic
1112730759 13:102358974-102358996 GAATACTATGCAGCCATAAAAGG + Intronic
1112762467 13:102706648-102706670 GAATACTATGCAGCCATAAAAGG - Intergenic
1112863966 13:103870994-103871016 GCAAACTATGCATCCAAAAAAGG - Intergenic
1113002071 13:105652057-105652079 GAATATCATTCAGCCTTAAAAGG + Intergenic
1113124350 13:106959967-106959989 GAAAATTATTCAGCAATAAATGG - Intergenic
1114158257 14:20132016-20132038 GAATACTATCCAGCTATAAAAGG - Intergenic
1114161011 14:20167386-20167408 GAATACTACTGAGCAATAAAAGG + Intergenic
1114380274 14:22196278-22196300 GAATATTATTCAGCCTAAAAAGG + Intergenic
1114958663 14:27854631-27854653 GAATACTATGTAGCCATAAAAGG + Intergenic
1115061435 14:29195260-29195282 GAAAACTACTCAGCAATAAAAGG - Intergenic
1115129996 14:30043276-30043298 GAATACTACTTAGCCATAAAAGG - Intronic
1115714143 14:36083940-36083962 GAATACTATGCAACCACGAAAGG - Intergenic
1115937666 14:38572622-38572644 GAATACTACTCAACCATCAAAGG - Intergenic
1116016736 14:39416906-39416928 GACAACAATGCAGCCATACAAGG - Intronic
1116531947 14:45982201-45982223 GAATACTATTCATCTTTAAATGG - Intergenic
1116651050 14:47593533-47593555 GAATACTATGCAGCCAGAAAAGG + Intronic
1116896060 14:50315743-50315765 GAATACTAGTTAGCCATAAAAGG - Intronic
1117026534 14:51626129-51626151 GAATACTATGCAGCCATAAAAGG + Intronic
1117080556 14:52147855-52147877 GAATACTATACAGCCATAAAAGG + Intergenic
1117110694 14:52450931-52450953 GAATACTACTCAGCCATAAAAGG + Intronic
1117231466 14:53723618-53723640 GAATATTATTCCGCAATAAAAGG - Intergenic
1117236528 14:53782938-53782960 GAATACTATACAGTTATAGAAGG + Intergenic
1117266943 14:54099120-54099142 GAATATTATTTAGCCACAAAAGG + Intergenic
1117312339 14:54540419-54540441 GAATATTATTCAGCCTTAAAAGG - Intergenic
1117371433 14:55081910-55081932 GAATATTATTCAGCCATAAATGG + Intergenic
1117482580 14:56162451-56162473 GAGTACTATTCAGCCATAAAAGG - Intronic
1117509642 14:56437406-56437428 GAATACTACACAGCCATAAAAGG - Intergenic
1117559916 14:56926791-56926813 GAATATTATTCAGCCTTAAAAGG - Intergenic
1117717155 14:58593247-58593269 GAATACTATGCAGCTGAAAAAGG + Intergenic
1117786333 14:59289788-59289810 GAATGCTATGCAATCATAAAAGG + Intronic
1117851083 14:59970277-59970299 GAATACTATGCAGCCTTTCCAGG - Intronic
1118398682 14:65359668-65359690 GATTATTATTCAGCCTTAAAAGG - Intergenic
1118547309 14:66905912-66905934 GAATACTATACAGCCATAAAAGG - Intronic
1118560878 14:67080943-67080965 TACTACTATTCAGCCAAAAAAGG - Intronic
1118622553 14:67626873-67626895 GAGTATTATTCAGTCATAAATGG + Intronic
1118784174 14:69032014-69032036 GAGTACTATTCAGCAATAAAAGG + Intergenic
1119082381 14:71707641-71707663 GAATATTATTCAGCTATGAAAGG - Intronic
1119284601 14:73442559-73442581 GAATACTACTCAACAATAAAAGG + Intronic
1119363993 14:74075884-74075906 GAATACTACTCAGCAAAAAAAGG + Intronic
1119454495 14:74743026-74743048 GAATACTGTTCAGCAATGAAAGG + Intergenic
1119581324 14:75784429-75784451 GAATATTATTCAGCCATAAAGGG - Intronic
1119692435 14:76686511-76686533 GACTACTACTCAGCAATAAAAGG - Intergenic
1120049067 14:79844085-79844107 GAATACTATTCAGCCATAAAAGG - Intronic
1120079083 14:80195284-80195306 GAATATTATTCAGCACTAAAAGG + Intergenic
1120258292 14:82148142-82148164 GAATACTATGCAGCATAAAAAGG - Intergenic
1120568317 14:86086420-86086442 GAATACTATGCAGCCATAAAAGG - Intergenic
1120638372 14:86979741-86979763 GAATATTATACAGCCATAAAAGG + Intergenic
1120683531 14:87510271-87510293 GAATACTGTTCAGCAATTAAAGG - Intergenic
1120974499 14:90236779-90236801 GAATATTATTCAGACATGAAAGG - Intergenic
1121209343 14:92195984-92196006 GAATACTATTCAGCCATAAAAGG - Intergenic
1121233459 14:92375608-92375630 GAATATTATTCAGCCTTAAAAGG + Intronic
1121424391 14:93838312-93838334 GAATATTATTCAGCTGTAAAAGG + Intergenic
1121528435 14:94636060-94636082 GAATACTACTCAGCCGTAAAAGG + Intergenic
1121893214 14:97618346-97618368 GAATACTACTCAGCAATAAAAGG + Intergenic
1122336838 14:100995992-100996014 GAATACTATGCAGCCATTAAAGG - Intergenic
1122376325 14:101261900-101261922 GAATATTACTCAGCAATAAAAGG - Intergenic
1123668930 15:22634638-22634660 GAATATAATTTAGCCATAAAAGG - Intergenic
1123698463 15:22896679-22896701 GAAAACAATGCAGAGATAAATGG - Intronic
1123784786 15:23659895-23659917 GAATACTATTCAGCCATAAAAGG + Intergenic
1123889898 15:24766509-24766531 GACTACTATTCAGGCATACAAGG + Intergenic
1124524897 15:30441131-30441153 GAATATAATTTAGCCATAAAAGG - Intergenic
1124591117 15:31053887-31053909 GAATATTATTCAGCCTTAAAAGG + Intronic
1124593332 15:31072361-31072383 GAATATTATTAAGCCATAAAAGG - Intronic
1124616204 15:31244133-31244155 GAATATCAATCAGCCATAAATGG - Intergenic
1124622812 15:31286040-31286062 AAAAATTCTGCAGCCATAAAAGG + Intergenic
1124668335 15:31613955-31613977 GAATATTACTCAGCCATAAAAGG + Intronic
1124773756 15:32566582-32566604 GAATATAATTTAGCCATAAAAGG + Intergenic
1124822378 15:33059231-33059253 GAATACCAATCAGCCTTAAAAGG - Intronic
1124988544 15:34647616-34647638 GAATAATATGCACACATTAAAGG + Intergenic
1125030832 15:35074328-35074350 GCAAACTATGCAGCCAACAAAGG - Intergenic
1125346650 15:38725361-38725383 GAATATCATTCATCCATAAAAGG + Intergenic
1125871789 15:43108782-43108804 GAATATTATTCAGCCTTTAAAGG + Intronic
1125873813 15:43126457-43126479 CAATATTATTCAGCCTTAAACGG + Intronic
1125983105 15:44021940-44021962 GAATAGTATTTAGCCTTAAAAGG + Intronic
1126219785 15:46199213-46199235 GAATATGATTCAGCCATAAAAGG - Intergenic
1126289875 15:47062030-47062052 AAATTTTATGCAGCCATTAAGGG + Intergenic
1126305631 15:47252733-47252755 GAATACTATTCAGCTATAAAAGG - Intronic
1126428180 15:48551843-48551865 GAATACTATACAGCCATAAAAGG - Intronic
1126515396 15:49529129-49529151 GAATACTATGCAGCCATAAAAGG + Intronic
1126532547 15:49727077-49727099 GAGTACTATACAGCTATAAAAGG + Intergenic
1126739449 15:51762884-51762906 GAATACTTCTCAGCAATAAAAGG - Intronic
1126830890 15:52603632-52603654 GAATATTATTCAGCCATAAGAGG + Intronic
1126836192 15:52668209-52668231 GAATACTATAGAGCCACAAAAGG + Intronic
1127133145 15:55889376-55889398 GAGTACTATCCAGCCATAAAAGG + Intronic
1127222280 15:56892252-56892274 CAATAATCTGGAGCCATAAAGGG - Intronic
1127368735 15:58315457-58315479 GAATACTATGCAGCCATAAAAGG - Intronic
1127469515 15:59277742-59277764 GAGTACTTTGCAGTCATTAAAGG + Intronic
1127521637 15:59748844-59748866 GAATACTATGAAGCCAAAAAAGG + Intergenic
1127629023 15:60808800-60808822 GAATACTACTCAGCCACAAAAGG + Intronic
1127757079 15:62103277-62103299 AAATAATATGCAGCCAAAAATGG + Intergenic
1127920009 15:63486827-63486849 GAATATTATTCAGCCATAAAAGG - Intergenic
1128012021 15:64306784-64306806 GAATATCATTCAGCAATAAAAGG + Intronic
1128257542 15:66209565-66209587 AAATACTATTCAACAATAAAAGG + Intronic
1128401355 15:67284793-67284815 GAATACTATGCAGCCATAAAAGG - Intronic
1128604885 15:69029335-69029357 GAATATTATTCAGCCTTAAAAGG - Intronic
1128724231 15:69975934-69975956 ATATACTATGTAGGCATAAAAGG + Intergenic
1128795928 15:70466524-70466546 GAAGACAATGCAGCCACAGATGG + Intergenic
1129013920 15:72448921-72448943 GAATACTACTCAGCAATAAAAGG + Intergenic
1129017872 15:72484604-72484626 GAATACTACTCAGCCATAAAAGG - Intronic
1129024229 15:72554058-72554080 AAATATTATTCAGCCATAAAAGG - Intronic
1129240285 15:74247496-74247518 TAATATTATTCAGCCATAAAAGG + Intronic
1129748648 15:78043599-78043621 GAATATTATTTGGCCATAAAAGG + Intronic
1129882153 15:79014394-79014416 GAATACTACTTGGCCATAAAAGG + Intronic
1129924579 15:79351873-79351895 GAATTCTACTCAGCCATAAAAGG + Intronic
1129947711 15:79555382-79555404 GAATATTATTTAGCCTTAAAAGG - Intergenic
1130077416 15:80701315-80701337 GAATACTATGATGCCACTAAGGG + Intronic
1130337429 15:82968667-82968689 GAATACTATGCACCTGTAAAAGG - Intronic
1130575418 15:85088448-85088470 GAATATTATGCAGACATAAAAGG - Intronic
1130584061 15:85166105-85166127 GAACATTATTCAGCCACAAAAGG + Intergenic
1130767793 15:86889731-86889753 TAATACTATGCAGCCATAAAAGG - Intronic
1130784254 15:87078273-87078295 GAATACTATGCAGCTGTAAAAGG - Intergenic
1130828574 15:87576118-87576140 GAATACTACTTAGCAATAAAAGG + Intergenic
1130920453 15:88339641-88339663 GAATACTATTCAGCAATAAAGGG - Intergenic
1131026380 15:89145600-89145622 GAATGCTAGGCAGCCAGAAGGGG - Intronic
1131038419 15:89241117-89241139 GAATATTATCCAGCTTTAAAAGG - Intergenic
1131110811 15:89763957-89763979 GAATATCATTCAACCATAAAAGG + Intronic
1131503576 15:92995595-92995617 GAATACTCTGCAACTGTAAAAGG - Intronic
1131602029 15:93859566-93859588 GAACAGTCTGCAGCAATAAATGG - Intergenic
1131791080 15:95966037-95966059 GAATAATATTCAGCAATAAAAGG + Intergenic
1131920459 15:97322145-97322167 GAATATTATTTAGCAATAAAAGG - Intergenic
1131946787 15:97630507-97630529 GAATACTATGCAGCCATAAAAGG - Intergenic
1132167674 15:99611822-99611844 CAATATTATTCAGCCAAAAAAGG + Intronic
1132173143 15:99684044-99684066 GAATACTACTAAGCCATAAAAGG - Intronic
1132442155 15:101878470-101878492 GAATACTACTCAGCCTTAATAGG - Intergenic
1132652111 16:1025959-1025981 CTATATCATGCAGCCATAAAAGG + Intergenic
1133178879 16:4037399-4037421 GGATACTGTCCAGCCATCAAGGG - Intronic
1133238259 16:4399279-4399301 GCATACTATGCAGTCTTCAAAGG + Intronic
1133440030 16:5813461-5813483 GAATATGATTCAGCCATAAAGGG + Intergenic
1133475744 16:6120126-6120148 GAACGTTATTCAGCCATAAAAGG - Intronic
1133515774 16:6507357-6507379 GAATATTATTCAACCTTAAAAGG + Intronic
1133595173 16:7284121-7284143 GAATGCTACTCAGCAATAAAAGG - Intronic
1133625936 16:7570887-7570909 AAATACTATGTAGCCATGAAAGG + Intronic
1133652512 16:7826058-7826080 GATTATTATTCAGCCATGAAAGG - Intergenic
1133718656 16:8473657-8473679 GAATACTATTCAGCAATAAAAGG + Intergenic
1133873017 16:9707196-9707218 GAATGCTGTACAGCAATAAAAGG + Intergenic
1133902677 16:9992136-9992158 GAATACTACTGAGCCATAAAAGG - Intronic
1134202794 16:12212811-12212833 CAATACTACTCAGTCATAAAGGG + Intronic
1134288897 16:12887424-12887446 GAATAGTATGCAGACATAAAAGG - Intergenic
1134289147 16:12889671-12889693 GAATACTATGCAGCCATAAAAGG + Intergenic
1134297545 16:12960571-12960593 GAATACTATGCAGCCATAAAAGG + Intronic
1134301693 16:12997313-12997335 GAATACTACTCAGCAATAAAAGG - Intronic
1134338717 16:13325706-13325728 GAACACTATGCAGCCATAAAAGG + Intergenic
1134878881 16:17726932-17726954 GAATACTACTCAGCCATAAAAGG + Intergenic
1135478199 16:22796730-22796752 GAATACTACTCATCCATAAAAGG - Intergenic
1135615779 16:23909789-23909811 GAATACTACTCAGCCATAAAAGG - Intronic
1136728838 16:32386997-32387019 AAATTCTATACAGCCAGAAAGGG + Intergenic
1136858838 16:33682858-33682880 GAATATTATTCAGCCTTAAAAGG + Intergenic
1137639499 16:50016025-50016047 GAATATTATTCAGCAATAAAAGG - Intergenic
1137659344 16:50191050-50191072 GAATATTATTCAACCTTAAAAGG - Intronic
1137955581 16:52825589-52825611 GAAGACTATGCAGCCATAAAAGG - Intergenic
1137974065 16:53015676-53015698 GAGTACTATGCAGCCATGAAAGG - Intergenic
1137981428 16:53073318-53073340 GAATAGTATTCAGCCTTAAAAGG - Intronic
1138255261 16:55552283-55552305 GAATACTACTCAGCAATGAAAGG - Intronic
1138809666 16:60133957-60133979 ATGTACTATGCAGCCATAAAAGG - Intergenic
1138923980 16:61568061-61568083 GAACACTAAGCAGCCATTAAAGG + Intergenic
1139110006 16:63878608-63878630 GAATACTTTGTGGCCATAAAAGG + Intergenic
1139192112 16:64876823-64876845 GAATACTGCTCAGCCATCAAGGG - Intergenic
1139216108 16:65124917-65124939 GAATATTGTTCAGCAATAAAAGG + Intronic
1140157610 16:72448920-72448942 GAGTACTATTCAGCCATAAAAGG - Intergenic
1140426806 16:74867911-74867933 GAATGCTACTCAGCAATAAAAGG - Intergenic
1140438461 16:74967952-74967974 GAATATTATTCAGCCTTAAAAGG + Intronic
1140577811 16:76192917-76192939 GAATACTACCCAGCAATAAAAGG - Intergenic
1140621417 16:76737764-76737786 GCATATTATTCAGCCATAAAAGG - Intergenic
1140649475 16:77071483-77071505 CAATACTATGCAACCCTAAATGG + Intergenic
1140655420 16:77134654-77134676 GAATACTATGCAGCCATAAAAGG - Intergenic
1140693399 16:77507339-77507361 GATTACTATGCAACCAAAAAAGG + Intergenic
1140697516 16:77549598-77549620 GAATAATATTCAGCACTAAAAGG - Intergenic
1140855984 16:78978178-78978200 GAATACTATTCAGTGATAAAAGG - Intronic
1141036638 16:80632220-80632242 GAATATTATTTAGCCATAAAAGG + Intronic
1141222999 16:82089305-82089327 GAACACAACTCAGCCATAAAAGG - Intronic
1141465418 16:84202692-84202714 GGAAACTATCCAGTCATAAAAGG + Intergenic
1141523042 16:84594113-84594135 GAGTGCTGTTCAGCCATAAAAGG - Intronic
1141737550 16:85863815-85863837 GAATACTACACAGAAATAAAAGG - Intergenic
1141787291 16:86210180-86210202 GAATATTATTCAGCAATAAAAGG - Intergenic
1141889493 16:86917294-86917316 GAATATTATTCAGCAGTAAAAGG - Intergenic
1141969446 16:87470725-87470747 GAATATTATGCAGTCTTAAAAGG + Intronic
1202997598 16_KI270728v1_random:130742-130764 AAATTCTATACAGCCAGAAAGGG - Intergenic
1203024285 16_KI270728v1_random:443084-443106 AAATTCTATACAGCCAGAAAGGG - Intergenic
1203120412 16_KI270728v1_random:1531352-1531374 GAATATTATTCAGCCTTAAAAGG + Intergenic
1142834661 17:2576105-2576127 GAATACTATACTGCAGTAAAAGG - Intergenic
1143333561 17:6156110-6156132 GAATACTACACAGCCATAAAAGG - Intergenic
1143422211 17:6802794-6802816 GAATACTATGCAGCCATTGCAGG - Intronic
1143603981 17:7970131-7970153 GAATATTACTCAGCCATAAAAGG - Intergenic
1144174922 17:12696024-12696046 GAATATTATTCAGCCTTAAAAGG - Intronic
1144238382 17:13285005-13285027 GAATATTATTCAGTCATAAAAGG - Intergenic
1144376115 17:14643842-14643864 GGATACGACTCAGCCATAAAAGG + Intergenic
1144424243 17:15126508-15126530 GAATACTACTCAGCCAAGAAAGG + Intergenic
1144569647 17:16388663-16388685 GAATATTATTCAGCCTTAAAAGG + Intergenic
1145038353 17:19556955-19556977 GAGTATTATTCAGCCTTAAAAGG + Intronic
1145201186 17:20946434-20946456 GAATACTATGCAGCAACTAAAGG + Intergenic
1145293615 17:21571077-21571099 GAATACTATGCAGCCATAAAAGG + Intronic
1145361850 17:22218808-22218830 GAATATTATTCAGCCTTAAAAGG + Intergenic
1145386362 17:22414862-22414884 GAATACTATGCAGCCATAAAAGG - Intergenic
1145723669 17:27096680-27096702 GAATACTATTCAGCCACAAAAGG - Intergenic
1146045958 17:29506902-29506924 GAATTTTATTCAGCTATAAAAGG + Intronic
1146714358 17:35071855-35071877 GAATACTACTCAGAGATAAAAGG + Intronic
1146750864 17:35378408-35378430 ATATACTACACAGCCATAAAAGG - Intergenic
1147503581 17:40990904-40990926 GAATATTATTCAGCCCTAAAAGG - Intergenic
1147529120 17:41257202-41257224 GAATACTATACAGAAAAAAAAGG - Intergenic
1148045938 17:44744435-44744457 GGATACCCTGCAGCCATAAAAGG - Intronic
1148281336 17:46349985-46350007 GAATATCATTCAGCCATAAAAGG + Intronic
1148303564 17:46567920-46567942 GAATATCATTCAGCCATAAAAGG + Intronic
1148532024 17:48402719-48402741 GAATATTATTCAGCAATAAAAGG + Intronic
1148982723 17:51592640-51592662 GAATAATAAAAAGCCATAAAGGG - Intergenic
1149033376 17:52108241-52108263 GAATACTACCCAGCCATAAAAGG + Intronic
1149088250 17:52746464-52746486 GAATAGTACTCAGCAATAAAAGG - Intergenic
1149108075 17:52993212-52993234 GAATACTATTCAGCCAAAAAAGG - Intergenic
1149376942 17:56053491-56053513 GAGTACTATTTAGCCATAAAAGG - Intergenic
1149402337 17:56311109-56311131 AAATATTATGTAGCCCTAAAAGG - Intronic
1149471427 17:56918850-56918872 AAATATTAGGTAGCCATAAAAGG - Intergenic
1149764333 17:59262395-59262417 GAATATTATTCAGCACTAAAAGG + Intronic
1149782802 17:59411409-59411431 GAATACTATTCAGCAATGAAAGG - Intergenic
1150321920 17:64221817-64221839 GAATATTATTCAGCCTTAAAAGG + Intronic
1150370750 17:64635664-64635686 GAATATTATTCAGCCATAAAAGG - Intronic
1150558082 17:66271681-66271703 GAATATTATTCAGCCATAAAAGG - Intergenic
1150866154 17:68852484-68852506 GAATACTATGCAGCCATGAAAGG + Intergenic
1150948338 17:69773038-69773060 GCAAACTATGCATCCAAAAAAGG + Intergenic
1151007606 17:70455876-70455898 GAATACTATGCAGCCATAAAAGG - Intergenic
1151075924 17:71272325-71272347 AAATACTATGCAGCCATAAAAGG - Intergenic
1151110349 17:71668935-71668957 GAATACTAAGCTACCAAAAATGG + Intergenic
1151753778 17:76058913-76058935 GAGTACCATGCAGCCATCAAAGG + Intronic
1151902858 17:77028523-77028545 GAATATTACCCAGCCATGAAAGG + Intergenic
1152384534 17:79963429-79963451 GAATATTATTCAGCCATAAAAGG - Intronic
1153169250 18:2296126-2296148 GAAAACTATTCAGCCATAAAAGG + Intergenic
1153374011 18:4355258-4355280 GACTACTACCTAGCCATAAAAGG + Intronic
1153385362 18:4488295-4488317 GAATATTATTCAACCATAAAAGG + Intergenic
1153399210 18:4665088-4665110 AAACACTATTCAGCAATAAAAGG + Intergenic
1153605854 18:6830654-6830676 GAATACTATGCAGCCATAAAAGG - Intronic
1153810225 18:8746081-8746103 GAATATTATTTAGCCTTAAAAGG - Intronic
1154043698 18:10884239-10884261 GAATATTATTCAGCCATAAAAGG - Intronic
1154054058 18:10994191-10994213 GACTACTACCCAGCCATAAAAGG - Intronic
1154085354 18:11299702-11299724 GAGTACTATGCAGCCATAAAAGG - Intergenic
1154249919 18:12735868-12735890 GAATATTATTCAGCCTTAACAGG + Intergenic
1154438735 18:14367837-14367859 GAATATTATTCAGCCTTAAAAGG + Intergenic
1154473138 18:14724161-14724183 GAATATTATTCAGCCACAGAAGG - Intergenic
1154996821 18:21648479-21648501 GAATACTATGCATCCATAAAAGG + Intergenic
1155124734 18:22861590-22861612 CAATACTATTTGGCCATAAAAGG + Intronic
1155596161 18:27490084-27490106 AAATACTAAGCAGCTCTAAAAGG - Intergenic
1155684452 18:28531641-28531663 GAATACTATGCAGCCATAAAAGG + Intergenic
1155723251 18:29046093-29046115 GAATACTATGCAGTTATAGAAGG - Intergenic
1156317846 18:35987576-35987598 GAATATTATTCAGCATTAAAAGG + Intronic
1156338969 18:36193942-36193964 GAATACTATTCTGCCATAACAGG + Intronic
1156779397 18:40833183-40833205 AAGTACTATGCCGCCATAAAAGG + Intergenic
1156787123 18:40929067-40929089 CAATAATATGTAGACATAAAAGG + Intergenic
1157144405 18:45146995-45147017 GCAAACTATGCATCCATCAAAGG - Intergenic
1157508846 18:48253104-48253126 GAATCCTATCCATCCTTAAAGGG - Intronic
1157657338 18:49403923-49403945 GACTATTATGCAGCCATAAAAGG - Intronic
1157821489 18:50774558-50774580 GAATGCTATTCAGCCATAAAAGG + Intergenic
1157973850 18:52302240-52302262 AAATACTACTCAGCCATAAAAGG - Intergenic
1158126948 18:54110598-54110620 GAATACTAGACAGCAACAAAAGG - Intergenic
1158274483 18:55751920-55751942 GAATATTATTCGGCCATAAGAGG - Intergenic
1158297675 18:56016436-56016458 GAATACTATTCAGCCATAAAAGG - Intergenic
1158445959 18:57521059-57521081 GAAAGCTATTCAGCCACAAAAGG + Intergenic
1158660180 18:59380129-59380151 GGATATTATTCAGCCATAAAAGG + Intergenic
1158765112 18:60441352-60441374 GAATACTATGCAGACATAAAAGG - Intergenic
1158961699 18:62593169-62593191 GAATATTACTCAGCAATAAAGGG + Intergenic
1159480734 18:68988197-68988219 GAATACTATGCAGCCATAAAAGG + Intronic
1159538776 18:69748960-69748982 AAATACTATGCAGCCATAAAAGG + Intronic
1159636191 18:70808006-70808028 GAATATTATTCAGTGATAAAAGG - Intergenic
1159686316 18:71424934-71424956 AAATACTATGCATCCACCAAAGG - Intergenic
1159686531 18:71428105-71428127 GAATACTACTCAGCCATAAAAGG - Intergenic
1159686544 18:71428328-71428350 GAATACTACTCAGCCATAAAAGG - Intergenic
1159686558 18:71428532-71428554 GAATACTACTCAGCCATAAAAGG - Intergenic
1159688070 18:71448389-71448411 TAATAAAATGCAGGCATAAAAGG - Intergenic
1159771214 18:72547153-72547175 GAATACTACTCAGCCATAAAAGG + Intronic
1160253869 18:77230425-77230447 GAATACTACTCAGCCATAACAGG + Intergenic
1160281631 18:77496075-77496097 GAAAACTAGGCAGCCTAAAAAGG - Intergenic
1160344150 18:78117461-78117483 AAATACTATTCAGCAATAAAAGG - Intergenic
1160642780 19:154685-154707 GAATACTACTCAGCCTTAATAGG + Intergenic
1161572777 19:5039646-5039668 GAAGACTCTGCAGCCAACAAGGG - Intronic
1163227357 19:15973684-15973706 GAATACTAGGCAGCCATAAAAGG - Intergenic
1164860283 19:31557159-31557181 GAATACTATTCAGCCATAAAAGG - Intergenic
1164887479 19:31794403-31794425 GAATACTATGCAGTCATAAAAGG - Intergenic
1164901368 19:31928320-31928342 GAATACTACTCAGCCATAAAAGG + Intergenic
1165809214 19:38600610-38600632 GATTAGGATGCAGCCAGAAAGGG - Intronic
1166263965 19:41665393-41665415 GAATACTACTCAGCCATAAAAGG + Intronic
1166428642 19:42702504-42702526 GAATACTACTCAGCCATAAAAGG - Intronic
1166456518 19:42945406-42945428 GAAAAAGATGCAACCATAAAAGG - Intronic
1167529407 19:50005675-50005697 GAATATCACGCAGCCATAAAAGG + Intronic
1167559764 19:50218945-50218967 GAATACTACTCAGCCATAAAAGG - Intronic
1167984555 19:53303461-53303483 GAATACTACTCAGCCATAAAAGG + Intergenic
1168069110 19:53939613-53939635 GAATACTATTCAGCCAAAAAAGG - Intronic
1168074762 19:53974294-53974316 GAATATTATTCAGCCTTCAAAGG - Intronic
1168128483 19:54300817-54300839 GAATACTACTCAGCCATAAGAGG + Intergenic
1168478687 19:56698362-56698384 GAATACTATGCAGCCATAAAAGG - Intergenic
1168554827 19:57329173-57329195 GAAGTCTGTGCAGTCATAAAAGG - Exonic
925663704 2:6230642-6230664 GAATACTAATTAGCCATAAAAGG + Intergenic
926071685 2:9899352-9899374 GAATATTATCCAGCCTGAAAAGG - Intronic
926402230 2:12509182-12509204 GAATACTACGCAGCTGTAAAAGG - Intergenic
926678524 2:15646899-15646921 GAATAATATTCAGTCTTAAACGG + Intergenic
927126202 2:20013776-20013798 GAATACTGTTCAGCCTTAAAAGG + Intergenic
927461160 2:23299348-23299370 GAATACCATCCGGCTATAAAAGG - Intergenic
927530257 2:23791133-23791155 AAATACTATTCAGCAATAAATGG - Intronic
927543891 2:23936253-23936275 GAATCTTATTCAACCATAAACGG + Intronic
927546041 2:23954356-23954378 GAATATTATTCAGCCATAAAAGG - Intronic
927567927 2:24130149-24130171 GAATACTATGCAGCCATAAAAGG - Intronic
927701888 2:25274340-25274362 CAATACTGGGCAGCCATAGAAGG - Intronic
927727257 2:25435578-25435600 GAATATTATTCAGCTGTAAAAGG - Intronic
927795374 2:26043571-26043593 GAATATTATTCAGCCTTAAAAGG + Intronic
927819700 2:26252675-26252697 AAATACTATGCAGCTGTAAAAGG - Intronic
927824066 2:26295225-26295247 GAATACTGTGCAGCCTTAAAAGG + Intergenic
928034842 2:27812514-27812536 GAATACTATGCAGCCATAAAAGG + Intronic
928050038 2:27982812-27982834 AAATATTATTCAGCCTTAAAAGG - Intronic
928144214 2:28757217-28757239 GAATATTATTCAGCCATAAAAGG - Intronic
928251118 2:29681635-29681657 GGAATATATGCAGCCATAAATGG + Intronic
928693573 2:33825404-33825426 GAATACTATGCATCCAAAAAAGG - Intergenic
928757175 2:34541345-34541367 GAATACTATGCAGCCATAAAGGG - Intergenic
928943669 2:36753012-36753034 GAATACTATGCAGCCATAAAAGG + Intronic
929384678 2:41391826-41391848 GAATGTTATTCAGCCTTAAAAGG - Intergenic
929606570 2:43238766-43238788 GAATAGTAATCAGCCACAAAAGG + Intronic
930081941 2:47457679-47457701 GAATACTATTCAGCTATACGAGG - Intronic
930229838 2:48832268-48832290 GAGTACTATTAGGCCATAAAAGG - Intergenic
930397136 2:50836656-50836678 AAATACTATTCAGCCTTAAAAGG - Intronic
930448499 2:51504585-51504607 AAATACTCCTCAGCCATAAAAGG - Intergenic
930568675 2:53056508-53056530 GAATACTATGCAGCCATAAAAGG + Intergenic
930658063 2:54026711-54026733 GAATTCTACTCAGCCATAAAAGG + Intronic
930737725 2:54796687-54796709 GCATACTAGGCATCCAGAAAAGG + Intronic
931099860 2:58985056-58985078 GAATGCAATGCAGCCACAAGTGG - Intergenic
931142202 2:59473999-59474021 GAATACTATGCAGCAATAAAAGG + Intergenic
931189590 2:59987379-59987401 GAATACTATACAGCCATAAAAGG + Intergenic
931310086 2:61070145-61070167 GAATATTATGCATTGATAAATGG - Intronic
931319316 2:61160472-61160494 GAATACTATTCAGCTTTAAAAGG - Intronic
931335401 2:61336974-61336996 AAATATCATGCAGCCATTAAGGG - Intronic
931506446 2:62932376-62932398 GAATATTATTCAGCCTGAAAAGG + Intronic
931585034 2:63816778-63816800 GAATGCTATTCAGTAATAAAAGG + Intronic
931756235 2:65377050-65377072 GAATATTGTGCAGATATAAAAGG - Intronic
931784386 2:65606228-65606250 GAATATTATTCAGCCTTAAAAGG + Intergenic
931917883 2:66979032-66979054 GAATACTATGTAACCAAAAAAGG + Intergenic
932019592 2:68069542-68069564 GAATACTATGCAGCCATAAGAGG + Intronic
932064755 2:68542948-68542970 GAATATTATTCAGCCTTAAAAGG + Intronic
932176984 2:69611799-69611821 GAATATTATTTAGCCTTAAAAGG + Intronic
932186548 2:69701544-69701566 TAATACTATTCAGCCTTAAAAGG - Intronic
932358191 2:71084017-71084039 GAATTCTACTCAGCAATAAAAGG + Intergenic
932370530 2:71183584-71183606 GAATTCTACTCAGCAATAAAAGG + Exonic
932551614 2:72775558-72775580 GAGTACTATTCAGCAAAAAAAGG + Intronic
932680374 2:73819331-73819353 GAATACTATGCAGTATGAAAAGG - Intergenic
932711988 2:74072931-74072953 GAATATTACTCAGCCAAAAAAGG - Intronic
932880586 2:75498135-75498157 GAATACTAAGCAGCCATAAAAGG + Intronic
932903237 2:75724008-75724030 GAATACTAGGCAGCCATAAAAGG + Intergenic
933029120 2:77303793-77303815 GGATACTATTCAGCCATAAAAGG - Intronic
933365919 2:81353923-81353945 GAATACTATACAGCCATAAAAGG + Intergenic
933433078 2:82209949-82209971 GAAAACTATGCATCCAACAAAGG - Intergenic
933472682 2:82746841-82746863 GAATACTATGCAGCCATAAAAGG - Intergenic
933534245 2:83552331-83552353 GAATACTATGCAGCCACAAAAGG - Intergenic
933550058 2:83765020-83765042 GAATACTATGAAGACATATAAGG - Intergenic
933984512 2:87579646-87579668 GAATATTATTCAGCCTTAAAAGG + Intergenic
934045082 2:88166670-88166692 GAAAATTATTCAGCCATAAAAGG - Intergenic
934087676 2:88524068-88524090 GAATATTATTCAGCCTTAAAAGG - Intergenic
934478624 2:94613416-94613438 GAATACTATGCAGCCATAAAAGG - Intergenic
934665746 2:96168908-96168930 AAAAATTATTCAGCCATAAAAGG + Intergenic
934742706 2:96737205-96737227 GAAGACAATGCAGCTAGAAAAGG + Intronic
935024730 2:99265485-99265507 GAATACTACTCAGCCATAAAAGG - Intronic
935044878 2:99472209-99472231 AAATACTATTCAGCCTTAAAAGG + Intronic
935071913 2:99702000-99702022 GAATGCTACCCAGCAATAAAAGG - Intronic
935192612 2:100791069-100791091 GAATATTATTCAGCTTTAAAAGG - Intergenic
935258490 2:101333799-101333821 CAATATTGTGCAGCCAAAAATGG - Intergenic
935480009 2:103575485-103575507 GAATGCTACTCAGCCATGAAAGG + Intergenic
935661941 2:105474323-105474345 GAATATTACTCAGCCTTAAAAGG - Intergenic
935864457 2:107370445-107370467 GGATACTATTCAGCCATAAAAGG - Intergenic
935864660 2:107373888-107373910 GAATATTATTCAGCAATAAAAGG + Intergenic
935945113 2:108279063-108279085 GAATACTATTCAGCCATAAAAGG + Intergenic
936121003 2:109745057-109745079 GAATATTATTCAGCAATAAAAGG + Intergenic
936223692 2:110626414-110626436 GAATATTATTCAGCAATAAAAGG - Intergenic
936309343 2:111371154-111371176 GAATATTATTCAGCCTTAAAAGG - Intergenic
936771916 2:115923923-115923945 GAATACTACTCAGCCATAAAAGG - Intergenic
936782034 2:116045091-116045113 GTAAACTATGCATCCATCAAAGG + Intergenic
937068749 2:119044766-119044788 GAATACTACTCAGCCATAAAAGG - Intergenic
937109005 2:119348312-119348334 AAATACCCTGCAGCCATTAAAGG + Intronic
937135786 2:119551091-119551113 GAATGCTGTTCAGCCATAAAAGG - Intronic
937174358 2:119913067-119913089 GAAAATTATTCAGCAATAAAGGG - Intronic
937195272 2:120149573-120149595 AAATATTATACAGCCATAAAAGG - Intronic
937525995 2:122770816-122770838 GACTACTATTCAGCTTTAAAAGG + Intergenic
937751696 2:125482962-125482984 GAATACTACTCAGCCAAAAAAGG - Intergenic
937940889 2:127285043-127285065 AAAAACTATACAGCAATAAAAGG + Intronic
937969704 2:127540016-127540038 GAATACTACTCAGCCATAAAAGG - Intronic
938508027 2:131907517-131907539 GAATATTATTTAGCCTTAAAAGG + Intergenic
938719548 2:134053962-134053984 GAATATCATTCAGCCTTAAAAGG + Intergenic
938735783 2:134185527-134185549 GATTACTGTGCAGCCAACAAGGG + Intronic
938939723 2:136159232-136159254 GAGTACTATTCAGCCATAAAAGG + Intergenic
939104238 2:137930572-137930594 GAATATTATTCAGCCTTAAATGG - Intergenic
939118163 2:138085236-138085258 GAATACTATGCAGCCATAAAAGG - Intergenic
939143611 2:138386185-138386207 TAATACCATGCAGCCAGAGATGG - Intergenic
939364830 2:141218439-141218461 GAACACTATGTAGCCATAAAAGG + Intronic
939726867 2:145731612-145731634 GAAAACTAAGCAACTATAAAAGG + Intergenic
939786348 2:146518001-146518023 GGATACTACTCAGCCATAAAAGG - Intergenic
940130284 2:150373516-150373538 GAATACTATTTGGCAATAAAAGG - Intergenic
940137187 2:150451188-150451210 GAATATTATTTAGCCCTAAAAGG - Intergenic
940236739 2:151519279-151519301 GAATATTATTTAGCCATAAAAGG + Intronic
940548590 2:155122248-155122270 GAATAATATGCAGAAATAAGTGG - Intergenic
940581200 2:155583636-155583658 GAATACTACCCAGTCTTAAAAGG - Intergenic
940635035 2:156289002-156289024 GAATACTATACAGCCACAAAAGG - Intergenic
940936326 2:159499361-159499383 GAATACTATGCAGCCATAAAAGG - Intronic
940968143 2:159863146-159863168 GAGTACTACTCAGCCATAAAAGG - Intronic
941063429 2:160874142-160874164 GACTATTATTCAGCCATGAAAGG + Intergenic
941119826 2:161515450-161515472 GAATACTATGTGGCAATAAAAGG + Intronic
941279106 2:163527765-163527787 GAATATTATTAAGCCATAAAAGG + Intergenic
941592450 2:167436913-167436935 TTACACTATGCAGACATAAATGG + Intergenic
941680104 2:168388903-168388925 GAATACTACTTAGCCATAAAAGG + Intergenic
941736715 2:168985598-168985620 GAATACTACTCAGCAATAAAAGG + Intronic
941841757 2:170092710-170092732 GAATATTATTCAACCATAAAAGG + Intergenic
942348975 2:175032811-175032833 GAATACTATGCAGCCATAAAAGG - Intergenic
942748352 2:179262022-179262044 AAATAATATTCTGCCATAAAAGG + Intronic
942804100 2:179909569-179909591 GAATATTATTCAGCAATAAAAGG + Intergenic
942856807 2:180558580-180558602 GAATACTATGCAGCCATAAAAGG + Intergenic
942906911 2:181194022-181194044 GAATATTATTCAGCACTAAAAGG + Intergenic
942995640 2:182256667-182256689 GAATACTATGCAGCCATAAAAGG + Intronic
943003345 2:182358172-182358194 GAACACTATGAAGCCATTACAGG - Intronic
943007511 2:182403640-182403662 GAATACTATGCAGCCATAAAAGG + Intronic
943087316 2:183328318-183328340 GAATACTAGTCAGCCTTAAAAGG - Intergenic
943202747 2:184849870-184849892 GAATATTTTTCAGCCATAAAAGG + Intronic
943251476 2:185525816-185525838 GAATACTATTCAGCCAAAAAAGG - Intergenic
943390432 2:187260620-187260642 GAATACTATGCAGCCATAAGAGG + Intergenic
943530315 2:189071542-189071564 CAATTCTATGAAGCCATTAAAGG - Intronic
943787359 2:191892770-191892792 GAATATTATTCAGCTTTAAAAGG - Intergenic
944095409 2:195961586-195961608 GAATGCTATTCAGCCTTAGAGGG - Intronic
944485713 2:200202779-200202801 GAATATTATATAGCAATAAAAGG + Intergenic
944562704 2:200956818-200956840 GAGTACTATGCAGCCATAAAAGG + Intronic
944921474 2:204418214-204418236 GACTACTACTCAGCAATAAAAGG + Intergenic
944928771 2:204494242-204494264 GAATATTATTCAGCCATAAACGG + Intergenic
945004915 2:205394643-205394665 GAATATTATTCAGCCTTAAAAGG + Intronic
945149580 2:206775081-206775103 GAATATTATTCAGCCTTAGAAGG - Intronic
945540187 2:211075857-211075879 GCATACTATGCATCCAACAAAGG + Intergenic
945563110 2:211362666-211362688 GAATACTATGCAGCCATTAAAGG - Intergenic
945596931 2:211807479-211807501 GAATACTGTGCAGCCATAAAAGG - Intronic
945851397 2:215012432-215012454 GAATACTATTTGGCAATAAAAGG + Intronic
945865253 2:215167452-215167474 GAATACTATGCAGCCATAAAAGG + Intergenic
945871557 2:215232045-215232067 GAAAACTATGCAGCACGAAATGG + Intergenic
946332560 2:219018617-219018639 GAAGACCATTCAGCCATGAATGG - Intronic
946587828 2:221210199-221210221 GAACACTATGCAGCCATAAAAGG + Intergenic
946778328 2:223167308-223167330 GAATATTATTCAGCCTTGAAAGG + Intronic
947250493 2:228097819-228097841 GAATACTACACAGCTATAAAAGG - Intronic
947671945 2:231942829-231942851 GAATATTATTTGGCCATAAAAGG - Intergenic
947688273 2:232110503-232110525 GAATACTTTGCAGCATAAAAAGG + Intronic
947881808 2:233522101-233522123 GATTACTATGTAGCCATTCAAGG + Intronic
948031075 2:234818017-234818039 AAATACTTGGCAGACATAAAGGG - Intergenic
948077081 2:235173267-235173289 GAATACTCTGCAGCCTAAAAAGG - Intergenic
948276699 2:236714543-236714565 GCAGACTGTGCAGCCATGAATGG + Intergenic
948370343 2:237485327-237485349 GGATACTCTGCAACCAAAAAAGG + Intergenic
948579716 2:238977614-238977636 GAATATTATTCAATCATAAAAGG + Intergenic
948780271 2:240317117-240317139 GTATATTATTCAGCCATAAAGGG + Intergenic
1168898364 20:1339229-1339251 TAATTCTATGCTGCCATCAAAGG + Intronic
1169174273 20:3495695-3495717 GAGTACTATGTAGCTATAAAAGG + Intronic
1169334647 20:4746172-4746194 GAATGTTATTCAGGCATAAAGGG + Intergenic
1169370349 20:5024155-5024177 GAATATTATTCAGCCTTAAAAGG - Intergenic
1169579749 20:7006820-7006842 GAATACTATTCAGCCTTAAAAGG + Intergenic
1169624346 20:7547067-7547089 ATATACGATGGAGCCATAAAAGG + Intergenic
1169655752 20:7921193-7921215 GCATACTATGCATCCAACAAAGG + Intronic
1170259775 20:14391276-14391298 GAATACTATGCAGCCATAAAAGG + Intronic
1170270276 20:14519870-14519892 GCATACTATGCAGCCATAAAAGG + Intronic
1170378023 20:15723627-15723649 AAATATTATCCAGCTATAAAAGG - Intronic
1170489009 20:16852098-16852120 GAATACTACTCAGCCATAAAAGG - Intergenic
1170726423 20:18931471-18931493 GAATACTACTCAGCCATAAAAGG - Intergenic
1170763422 20:19271642-19271664 GAATACCATTCAGCCATAAAAGG + Intronic
1170862446 20:20119950-20119972 GAATACTATGCAGCCTTTGCAGG - Intronic
1170904550 20:20501806-20501828 GAATACTTTGAGGCCATCAAGGG + Intronic
1171005003 20:21455782-21455804 GAATACTATGCAGCCATAAAAGG - Intergenic
1171038784 20:21740465-21740487 GAATAGTATACAGTCATAAAAGG - Intergenic
1171075018 20:22114400-22114422 GAATACTGTGCAGCCATAAGGGG + Intergenic
1171166062 20:22972856-22972878 CAATACTATGCAGCCATAAAAGG + Intergenic
1171944641 20:31365685-31365707 GAATACTACTCAGCAATAAAAGG + Intergenic
1172019412 20:31902526-31902548 GAATATTATTCAGTCATAAAAGG - Intronic
1172451187 20:35024495-35024517 GGATATTATTCAGCAATAAAAGG - Intronic
1172469940 20:35185540-35185562 GAGTACTACTCAGCCATAAAAGG + Intergenic
1172738700 20:37149017-37149039 AAGTACTATTCAGCCATAAAAGG - Intronic
1172741439 20:37171126-37171148 TAATACTATTCAGCAATTAAAGG - Intronic
1172957839 20:38773943-38773965 GAATGTTATTCAGCCTTAAAAGG - Intergenic
1172988837 20:39016478-39016500 GAATATTATTCAGTGATAAAAGG - Intronic
1173056144 20:39615127-39615149 GAACACTACTCAGCAATAAAAGG - Intergenic
1173076494 20:39824385-39824407 GCATAATAAGCAGCCACAAATGG + Intergenic
1173095906 20:40027974-40027996 GAATACTATTCAGCCACAAAAGG - Intergenic
1173187912 20:40855424-40855446 GATTAATATGAAGTCATAAAGGG + Intergenic
1173316314 20:41947736-41947758 GAATATTACTCAGCCATAATAGG + Intergenic
1173505420 20:43583286-43583308 GAATACTAGGCAGAGATGAATGG + Intronic
1173611873 20:44374367-44374389 GAATAGTATGCAGCCATAAAAGG - Intronic
1174083484 20:47987644-47987666 AAATACTATTCAGCCATGAAAGG - Intergenic
1174680169 20:52399034-52399056 GAGTACTACTCAGCCATAAAAGG + Intergenic
1174926056 20:54761246-54761268 GAATACTATTCAGCAATAAAAGG + Intergenic
1175204120 20:57298500-57298522 GAATATTATTCAGCCGTGAAAGG + Intergenic
1175555662 20:59854035-59854057 TAATATTATTCAGCTATAAAAGG - Intergenic
1175563211 20:59950691-59950713 GAATACTACTCAGCCATTAAAGG - Intergenic
1175621588 20:60452244-60452266 GAATATTACTCAGCCATAAAAGG + Intergenic
1175679946 20:60978736-60978758 GAATATTATTCTGCCATAGAAGG - Intergenic
1176456949 21:6921595-6921617 GAATATTATTCAGCCTTAAAAGG - Intergenic
1176685127 21:9839950-9839972 AAATACTATTCAGTCATCAAAGG - Intergenic
1176801344 21:13433688-13433710 GAATATTATTCAGCCACAGAAGG + Intergenic
1176835122 21:13786655-13786677 GAATATTATTCAGCCTTAAAAGG - Intergenic
1176988399 21:15464618-15464640 GAATACTATGCAGCCATAAAAGG + Intergenic
1177110146 21:17017562-17017584 GAATACTATGCAGCCAAAAAAGG + Intergenic
1177133677 21:17287745-17287767 GAGTATTATGCAGCCATAAAAGG + Intergenic
1177227140 21:18271914-18271936 GGATACTATGCAGCCATAAAAGG - Intronic
1177237743 21:18414692-18414714 GATTATTATTCAGCCTTAAAAGG - Intronic
1177279204 21:18957518-18957540 GAATACTATTCAGCCACAAAAGG - Intergenic
1177351898 21:19953793-19953815 GAATACTATGCCACCATAAAAGG + Intergenic
1177367851 21:20160753-20160775 GCATATTACTCAGCCATAAATGG + Intergenic
1177372056 21:20217490-20217512 GCAAACTATGCATCCAAAAAAGG + Intergenic
1177390463 21:20462161-20462183 GAATATTATTCAGACTTAAAAGG + Intergenic
1177416208 21:20796750-20796772 GAATACTATGCAGCCATAAAAGG + Intergenic
1177540292 21:22484083-22484105 AAATACTATGCAGCCTTAAAAGG - Intergenic
1177556554 21:22696553-22696575 AAATATTATTCAGCCATAAAAGG - Intergenic
1177659444 21:24063974-24063996 GAAAACTATGCAGCCATAAAAGG + Intergenic
1177882620 21:26711963-26711985 GAATACTACTCAACCATATAAGG - Intergenic
1177951434 21:27542998-27543020 GAATACTATACAGCTAAAAAAGG + Intergenic
1177983497 21:27944797-27944819 GAATATTATTTAGCCTTAAAAGG - Intergenic
1177985100 21:27964502-27964524 GAATACTATTTTCCCATAAAAGG - Intergenic
1178069646 21:28949678-28949700 GGATATTATTCAGCCTTAAAAGG - Intronic
1178297688 21:31424444-31424466 GAATATTATTCAGCCTTAAAAGG + Intronic
1178309724 21:31519706-31519728 GAATACTATTCAGCCTTAAAAGG + Intronic
1178380929 21:32107383-32107405 GAATACTACCCAGCACTAAATGG - Intergenic
1179040547 21:37798574-37798596 GAATATGATTCAGCCATAAAAGG + Intronic
1179193836 21:39146251-39146273 GAATACTACTCAGCAATAGAAGG - Intergenic
1179217860 21:39382598-39382620 GGATACTATTCAGCCTTAAAAGG - Intronic
1179453455 21:41481235-41481257 GAATACGATTCAGCCAGAAGAGG + Intronic
1180543646 22:16477988-16478010 AAATTCTATACAGCCAGAAAGGG - Intergenic
1181373159 22:22433903-22433925 GAATATTACCCAGCCATAAAAGG - Intergenic
1181827926 22:25534610-25534632 GAATACTAGTCAGCCTTAAAAGG - Intergenic
1181965210 22:26651695-26651717 GAATATTATTCAGTCATAAAAGG + Intergenic
1182113081 22:27737731-27737753 AAATACTACTCAGCAATAAAAGG + Intergenic
1182175682 22:28285198-28285220 AAATATTATTCAGCCATAAAAGG + Intronic
1182210263 22:28670517-28670539 GAGTATTATTCTGCCATAAAAGG - Intronic
1182408862 22:30164135-30164157 GAATATTATTCAGCTTTAAAAGG - Intronic
1182798890 22:33014223-33014245 GAATACCATTCAGCCTTAAAAGG - Intronic
1182960871 22:34473858-34473880 GAACACTATTCAGCCATAAAAGG - Intergenic
1183449491 22:37884239-37884261 GGATATTATTCAGCTATAAAAGG - Intronic
1183766861 22:39885635-39885657 GAATATTATTCAGACATAAAAGG + Intronic
1184012797 22:41761972-41761994 GTATATTAATCAGCCATAAAAGG - Intronic
1184258325 22:43299964-43299986 GAATACTGTTCAGCCGTAAAAGG - Intronic
1184299601 22:43548842-43548864 GCATACTATCCATCCACAAATGG + Intronic
1184362788 22:44028490-44028512 GAATATTATTCAGTCAAAAAAGG - Intronic
949109359 3:239930-239952 GAATACTACTCAGCCATGAAAGG - Intronic
949218247 3:1597834-1597856 AAATACTATACAGCCATAAAGGG - Intergenic
949307918 3:2663797-2663819 CAATACTATTCAGCAATAATAGG + Intronic
949380580 3:3441080-3441102 AAATACTATTTAGCCTTAAAAGG + Intergenic
949381535 3:3451510-3451532 GAATACTAAGCTGCCATATAAGG - Intergenic
949594298 3:5528143-5528165 GAATACTATGCAGCCATAAATGG - Intergenic
949958974 3:9295977-9295999 GAATATTATTCAGCCTCAAAAGG - Intronic
950402512 3:12780622-12780644 GAATATTCTTCAGCAATAAAAGG + Intergenic
950504461 3:13385844-13385866 GAGCACTATTCAGCCTTAAAAGG + Intronic
950636011 3:14315278-14315300 GAGTATTATCCAGCCACAAAGGG - Intergenic
950748669 3:15111223-15111245 AAATACTATGTAACCATAGACGG + Intergenic
950881292 3:16324621-16324643 GAATACTATGCAACCTTAAAAGG - Intronic
950910203 3:16581574-16581596 GAGTACTACTAAGCCATAAAAGG + Intergenic
950966200 3:17147780-17147802 GAATGCTGTGAAGCCATGAAAGG + Intergenic
951069734 3:18313122-18313144 GAATATTAGTTAGCCATAAAAGG - Intronic
951120865 3:18926666-18926688 GAATGGTATTCAGCAATAAAAGG + Intergenic
951260213 3:20498601-20498623 GAATACTACTCAGCCATAAAAGG - Intergenic
951404560 3:22279444-22279466 GAATACTATTCAGCCTTAAAAGG - Intronic
951412692 3:22384084-22384106 GAATACTATTCAGCCATAAAAGG + Intergenic
951760553 3:26143046-26143068 GAGTACTATTCAGCCCTAAACGG + Intergenic
951793402 3:26511505-26511527 GAATACTACTCAGCCATAAAAGG - Intergenic
952060882 3:29508536-29508558 GAATACTAAGCAGCCACAAAAGG - Intronic
952128207 3:30328365-30328387 GAGTACTATACAGTGATAAAAGG + Intergenic
952132461 3:30381802-30381824 GAATACTATGAAGCCATAAAAGG - Intergenic
952164759 3:30735445-30735467 GAATACTACTCAGCAATTAAAGG + Intronic
952240801 3:31530068-31530090 GAATATTGAGAAGCCATAAAGGG - Intergenic
952332405 3:32376259-32376281 GAATACTGCTCAGCAATAAAAGG + Intergenic
952370083 3:32713847-32713869 GAATATTATTCAGCCACAAAAGG - Intronic
952475339 3:33703891-33703913 GAATAGTATTCAGCACTAAAAGG + Intronic
952778393 3:37069376-37069398 GAATATGATTCAGCCTTAAAAGG + Intronic
952795705 3:37237044-37237066 AAATACTATGCAGCCATTAAAGG + Intergenic
953080721 3:39614924-39614946 GAATGCTACTCAGCCATAAAAGG + Intergenic
953460072 3:43074954-43074976 GAATACTACTCAGCAACAAAAGG - Intergenic
953816020 3:46157421-46157443 GAATACTATGCAGTTATAAAAGG - Intergenic
953835640 3:46340819-46340841 GAATACTACTCAGCCATAAAAGG + Intergenic
953847538 3:46439684-46439706 GAATGTTATTCAGCAATAAAAGG + Intronic
953869162 3:46611334-46611356 GAATATTGTGCAGCAATAAGAGG - Intronic
954057847 3:48042803-48042825 GAATATTATTCAGCCATAAAAGG + Intronic
954940807 3:54371052-54371074 GAATATCATTCAGCAATAAAAGG - Intronic
955132116 3:56180469-56180491 GAATATTATTCAGCCATAAAAGG + Intronic
955204154 3:56880110-56880132 TAATACTATGTGGCAATAAATGG + Intronic
955240340 3:57172278-57172300 GAATACTACTCAGCCATAGAAGG - Intergenic
955436894 3:58910069-58910091 TAATACTATGCAGCCATAAAAGG - Intronic
955446463 3:59016180-59016202 GAATACTATCCAGCCATAAAAGG + Intronic
955595599 3:60587157-60587179 GAATACTATGCAGCCAAAAAAGG + Intronic
955679241 3:61483133-61483155 GAATATTATTTAGCCAAAAAAGG - Intergenic
956140971 3:66147011-66147033 GAATACTTCTCAGCCATAAAAGG - Intronic
956252259 3:67246742-67246764 GAATACTATGCAGCCATATAAGG - Intergenic
956301183 3:67774640-67774662 GCATCCAATGCAGCTATAAAAGG - Intergenic
956395849 3:68825311-68825333 GAATACTTTGCAGCATAAAAAGG - Intronic
956800926 3:72757629-72757651 GAATACCATGCAGCCATAAAAGG + Intronic
957241463 3:77666237-77666259 GAATACTATGCAGCCATAAAAGG + Intergenic
957417678 3:79928019-79928041 GAATACTATGCAGCCATAAAAGG - Intergenic
957537335 3:81523835-81523857 GAATACTATTCAGCCATAAAAGG - Intronic
957976604 3:87453501-87453523 GGATACTATGCAGCCATAAAAGG - Intergenic
958087850 3:88835406-88835428 GAATACTACACAGCCATAAAAGG - Intergenic
958091616 3:88883994-88884016 GAAAACTATGCAGTCATCCAGGG - Intergenic
958149706 3:89674236-89674258 ATATACTATTCAGCCCTAAAAGG - Intergenic
958157032 3:89768455-89768477 GAACACTATGAAACCATCAATGG - Intergenic
958460722 3:94391274-94391296 GAAAACTATGCATCCACTAAAGG + Intergenic
958527553 3:95283278-95283300 GAATACAATGCAGCCATAAAAGG - Intergenic
958746692 3:98144359-98144381 GAATACTATGCATCCTTAAAAGG - Intergenic
958764444 3:98348119-98348141 GAATACTATTTGGTCATAAAAGG + Intergenic
958821185 3:98975715-98975737 GAATACTATGCAGCCATAAAAGG + Intergenic
959205331 3:103299524-103299546 AACTACTATGCAGCCATAAAAGG - Intergenic
959256693 3:104024328-104024350 GAATACTGTGAATCCATAAAAGG + Intergenic
959404812 3:105948203-105948225 GAATACTTTTCAGGGATAAAAGG - Intergenic
959424285 3:106167094-106167116 GGATACTACTCAGCCATAAAAGG + Intergenic
959457261 3:106578185-106578207 GAATACTACTCAGACATAAAAGG + Intergenic
959463752 3:106659255-106659277 GAATACTACTCAACCATAAAAGG + Intergenic
959517133 3:107281153-107281175 GAGTACTATTCAGCAATAAAAGG + Intergenic
959714205 3:109414801-109414823 AAATACTACTCAGCAATAAAAGG + Intergenic
959773736 3:110132040-110132062 GACTACTACGCAGCCATAAAAGG + Intergenic
959817433 3:110691352-110691374 GAAAACTATTCAGTGATAAAAGG - Intergenic
959898617 3:111634251-111634273 GCATACTATTCTACCATAAATGG - Intronic
959995901 3:112679764-112679786 GAATACTATTTAGCAATAAAAGG - Intergenic
960253350 3:115482932-115482954 GAATACTACTCTGCAATAAAAGG + Intergenic
960517044 3:118613979-118614001 GAATACTACTCAGCCATAAAAGG + Intergenic
960532169 3:118777483-118777505 GAAAACTATGCATCCATAAAAGG + Intergenic
960653340 3:119976377-119976399 GAATATTATTCAGCCATAAAAGG + Intronic
961020792 3:123505066-123505088 GAGTATTATGCAGCCTTAAAAGG + Intronic
961071803 3:123937054-123937076 GAATACTACTCAACAATAAAAGG - Intronic
961175058 3:124828330-124828352 GAATACTACTCAGCAACAAAAGG + Intronic
961411242 3:126721931-126721953 GAGTATTATTCAGCCATAAAAGG - Intronic
961593365 3:127997381-127997403 GAATATGATTCAGCCTTAAAAGG + Intergenic
961671498 3:128535085-128535107 GAACACTATACAGCAATAAAAGG - Intergenic
961721782 3:128902045-128902067 GAAGAGAATTCAGCCATAAAAGG - Intronic
961770565 3:129246876-129246898 GAATATTATCCAGCTACAAAAGG + Intergenic
962151079 3:132893978-132894000 GAACACTATGCAGCCATAAAAGG + Intergenic
962393706 3:134995331-134995353 GAATGCTACTCAGCAATAAAAGG - Intronic
962418537 3:135206209-135206231 GAATATTACTCAGCAATAAAAGG - Intronic
962696440 3:137952070-137952092 GAATACTATGCAGCCATAAAAGG - Intergenic
962784826 3:138758062-138758084 GAATATTATTCAGCCATAAAAGG + Intronic
962861129 3:139402810-139402832 GAATACTACTCAGCCATAAAAGG - Intergenic
962983447 3:140511204-140511226 GAATACTATGTAGCCATAAAAGG - Intronic
962999843 3:140669566-140669588 AAATACTACTCAGTCATAAAAGG + Intergenic
963013107 3:140793930-140793952 GAATATTATTCAGCAATAAAAGG + Intergenic
963226234 3:142864841-142864863 GAATATTATTCAGCCATAAAAGG - Intronic
963385523 3:144587930-144587952 GAATACTATTCAGCAATTAAAGG - Intergenic
963460906 3:145613862-145613884 GAATACTAAGCTGCCATAAAAGG - Intergenic
963487042 3:145947834-145947856 GAATACTATGCAGCCATAAAAGG - Intergenic
963506923 3:146197986-146198008 GTATACTACTCAGCCATAAAAGG + Intronic
963757709 3:149253049-149253071 AAATACCTTGCAGCCATAAATGG - Intergenic
963936216 3:151056252-151056274 GAATACTACTCAGCAATAAAAGG - Intergenic
963973557 3:151455655-151455677 GAATACTATTCAGCAAAGAAAGG - Intronic
963996208 3:151712057-151712079 ATATACTATTCAGCCATAAAAGG + Intergenic
964332175 3:155615571-155615593 TAATACTGTCCAGTCATAAAAGG + Intronic
964580900 3:158236652-158236674 GAATACTACTCATCAATAAAAGG - Intronic
964639237 3:158890942-158890964 GAATACTATGCAGCCATAAAAGG + Intergenic
964842586 3:161010359-161010381 GAATACTATGCAGCCATAAATGG - Intronic
964891202 3:161537660-161537682 GAATACTATTCAGCCATAAAGGG - Intergenic
964941370 3:162160022-162160044 GAATATTATTCAGCATTAAAAGG - Intergenic
965052284 3:163666071-163666093 ACATACTACTCAGCCATAAAAGG - Intergenic
965174516 3:165314632-165314654 GTATATTATTCAGCCATAAAAGG - Intergenic
965187600 3:165484854-165484876 GAATATTATTCAGCCTAAAAAGG + Intergenic
965216394 3:165869520-165869542 GAATACTACTCAGCCATAAAAGG - Intergenic
965295132 3:166935561-166935583 GAATACTATGCAACCATAAAAGG - Intergenic
965343545 3:167519440-167519462 GAATACTATACAGCCACAAAAGG + Intronic
965396765 3:168168586-168168608 GAATACTACTCATCAATAAAAGG - Intergenic
965434431 3:168631356-168631378 GCAAACTATGCATCCAGAAAAGG - Intergenic
965462633 3:168986477-168986499 GAATATTATGCTTCTATAAAAGG - Intergenic
965526544 3:169725526-169725548 GAGTACTATTCAGATATAAAAGG - Intergenic
965560231 3:170055106-170055128 GAATATTATTCAGTCTTAAAAGG - Intronic
965579358 3:170250596-170250618 GAATATTATCCACCCATAAAAGG - Intronic
965703552 3:171482771-171482793 GAATATTATTCAGCCACAAAAGG - Intergenic
965726638 3:171723972-171723994 GAATATTATCCAGCCATAAAAGG - Intronic
965985469 3:174747966-174747988 GAATACTATGCAGCCGTAAAAGG + Intronic
966000070 3:174938361-174938383 CGATACGATGCAGCCATGAAAGG - Intronic
966083037 3:176028694-176028716 AAATACTATGCAGCCATAAAAGG - Intergenic
966096973 3:176215238-176215260 GAATATTAGTCAGCCTTAAAAGG + Intergenic
966098381 3:176234987-176235009 GAGTACTATGTAGCAATAAGAGG + Intergenic
966263501 3:178008996-178009018 GAATATTATGCAGCCATAAAAGG + Intergenic
966514348 3:180801361-180801383 GAATACTGCCAAGCCATAAAAGG + Intronic
966522172 3:180885710-180885732 GAACAATATGCACCAATAAAAGG + Intronic
966571384 3:181447599-181447621 GAATACTATTCAGCCTTAAATGG - Intergenic
966948255 3:184792988-184793010 GAATACAACTCAGCCATAAAAGG - Intergenic
967202632 3:187086006-187086028 GAATACTACTCAGCAATAAGAGG - Intergenic
967374611 3:188786733-188786755 GAATACGATTTAGCAATAAAAGG + Intronic
968174998 3:196541881-196541903 GAATACTATTGAGCAATAAAAGG - Intergenic
968254317 3:197252387-197252409 GAATATTATTCAGCTTTAAAAGG + Intronic
968353936 3:198086225-198086247 GAATATTATTCAGCCATTAAAGG + Intergenic
969133198 4:5007356-5007378 GAATACTATTCAGCCAAAAAGGG + Intergenic
970032151 4:11688235-11688257 GAATATTATTCAGAGATAAAGGG + Intergenic
970042756 4:11814701-11814723 GAATATTATTAAGCCATTAAAGG + Intergenic
970184710 4:13438615-13438637 TAATATTATTCAGCCAAAAAAGG - Intronic
970563806 4:17311208-17311230 GAATACTACTCAGCCATAAAAGG + Intergenic
970614522 4:17755713-17755735 AAATACTATGCAGCCATAAAAGG + Intronic
970794505 4:19894517-19894539 GAATACTATTCAGCAATCAAAGG + Intergenic
970836109 4:20409407-20409429 GAATACTATGCAGTCATAAAAGG - Intronic
970919594 4:21377683-21377705 GAATATTATGCACACATAATAGG + Intronic
970982192 4:22112580-22112602 GAATATTATTCAGCCATAAAAGG + Intergenic
971022795 4:22555189-22555211 GAATATTATTCAACAATAAATGG - Intergenic
971254851 4:25004943-25004965 GAATATTATTCAGCCCTAAAAGG + Intronic
971497405 4:27281549-27281571 CAATACTACCCAGCAATAAAAGG + Intergenic
971744694 4:30565212-30565234 GAATACTATACAGCCTGACATGG + Intergenic
971905466 4:32719030-32719052 GAATACTGCTCAGCCAAAAAAGG - Intergenic
971905469 4:32719257-32719279 GAATACTGCTCAGCCAAAAAAGG + Intergenic
971906585 4:32733549-32733571 GAATACTACGAAGCCACAAAAGG + Intergenic
971995857 4:33963069-33963091 GTATACTATGCAGCCATAAAAGG - Intergenic
972096084 4:35349003-35349025 GAATACTATGTAGCCATAAAAGG + Intergenic
972147704 4:36048544-36048566 AAATACTATGCAGCCATAAAAGG - Intronic
972232095 4:37085443-37085465 AAATATTATTCAGACATAAAAGG + Intergenic
972318381 4:37948957-37948979 GAGTATTATTCATCCATAAAAGG - Intronic
972383930 4:38545353-38545375 GAGTACTATTCAGCCGTAAAAGG - Intergenic
972531528 4:39965550-39965572 GAATATTATTCAGCTTTAAAAGG + Intronic
972593318 4:40508504-40508526 GAATACTATGCAGCAACAACAGG + Intronic
972800341 4:42468485-42468507 GAATACTACTCAACCATAAAAGG + Intronic
972828718 4:42789523-42789545 AAATAGGATGCAGCCATTAAAGG + Intergenic
972877232 4:43377681-43377703 GAATACTATGCAGCTGTGAAAGG + Intergenic
972970662 4:44571891-44571913 TAATATTATTCAGCTATAAAAGG - Intergenic
972986116 4:44768255-44768277 GAATATTATTCAGCCTTAAAAGG + Intergenic
973018188 4:45167491-45167513 GAATACTATGCTCCCATTAAAGG - Intergenic
973057179 4:45675364-45675386 GAATACTATTCAGCCATAAAAGG - Intergenic
973091272 4:46140084-46140106 CAATACTGTTCAGCAATAAAGGG - Intergenic
973141334 4:46772099-46772121 GAATATTATTGAGCCAAAAAAGG + Intronic
973237893 4:47925587-47925609 GAATACTACTCAGCCATTAAAGG + Intronic
973554332 4:52066839-52066861 GAATGCTATGCAGCCAAAAAAGG - Intronic
973823049 4:54679815-54679837 GACTATTATTCAGCCTTAAAAGG + Intronic
973873979 4:55195771-55195793 GGATAGTATGCAGCCATAAAAGG + Intergenic
973922275 4:55700165-55700187 GAATACTATGCAGCCATAAAAGG + Intergenic
973926324 4:55742191-55742213 GAAAACTACTCAGCCAAAAAAGG + Intergenic
974180733 4:58381148-58381170 GAATACTATGCAGCCATAAAAGG - Intergenic
974200615 4:58635007-58635029 TAATACTACTCAGCAATAAAAGG - Intergenic
974405266 4:61460351-61460373 GAATACTATTCAGCCATAAAAGG + Intronic
974472435 4:62336308-62336330 GAATACTACTCAGCCATAAAAGG + Intergenic
974495580 4:62622758-62622780 GAATACTCTGGAACCATTAATGG - Intergenic
974539358 4:63213842-63213864 GAATACTATGCAGCCATAAAAGG - Intergenic
974631110 4:64490236-64490258 AAATAATATGCAGGCATATATGG - Intergenic
974889815 4:67868110-67868132 GAATACTACTCAACCATAAAAGG + Intronic
974956741 4:68650483-68650505 GAATACTATGCACCATAAAAAGG - Intronic
974964333 4:68741918-68741940 CAATACTATGCATCCAACAAAGG + Intergenic
975192666 4:71483509-71483531 GAATACTATGCAGCCATAAAAGG - Intronic
975429794 4:74275282-74275304 GAATACTATGCAGCCACAAAAGG - Intronic
975494402 4:75021795-75021817 GAATACTATTCAGCCATAAAAGG - Intronic
975531962 4:75408796-75408818 GAATACTCTTCAGTCATAAAAGG - Intergenic
975537333 4:75465102-75465124 GAATATTATTCAGCCATAAAAGG - Intergenic
975553192 4:75633914-75633936 GAATATTACTCAACCATAAAAGG + Intergenic
975590323 4:75993460-75993482 GAATACTACTCAGGAATAAAAGG - Intergenic
975905630 4:79208567-79208589 GATTACTGTGCATCTATAAAAGG + Intergenic
976157627 4:82164376-82164398 CAATACTACTCAGCCATAAAAGG + Intergenic
976207666 4:82638181-82638203 GAATACTATGCAGCCATAAAAGG - Intronic
976226983 4:82802029-82802051 GAATATTATTCAGTCTTAAAAGG - Intergenic
976357948 4:84142425-84142447 GAATACTATTCAGCAATACAAGG + Intergenic
976363875 4:84211743-84211765 GAATACTACTCAGCCATAAAAGG + Intergenic
976537680 4:86237196-86237218 GAATACTATGCAGCCATAAAAGG - Intronic
976545647 4:86332798-86332820 GAATTTTAACCAGCCATAAATGG - Intronic
976609668 4:87016951-87016973 GAATACTATTCAGTAATAAAAGG - Intronic
976800436 4:88985092-88985114 AAATATTATTCTGCCATAAAAGG + Intronic
976906967 4:90249678-90249700 GAATATTATTCAGCAATAAAAGG - Intronic
976984142 4:91271611-91271633 GAATACTACTCAGCCATAAAAGG - Intronic
977068135 4:92345294-92345316 GAATACTACTCAGCCATAAATGG - Intronic
977318082 4:95476366-95476388 GGGTACTTTGCAGTCATAAAAGG + Intronic
977339054 4:95734337-95734359 GAATACTATGCAGCCATAAAAGG - Intergenic
977567898 4:98599766-98599788 GAATACTACTCAGCAACAAAAGG - Intronic
977575403 4:98668617-98668639 GAATGTTATTCAGCCTTAAAAGG + Intergenic
977814763 4:101402183-101402205 GAATGCTATGCAGCCATAAAAGG + Intergenic
977992109 4:103456726-103456748 GAACACTACACAGCCATAAAAGG + Intergenic
977997246 4:103509459-103509481 GAATACTAAGCAGCCATAAAAGG - Intergenic
978022673 4:103832813-103832835 GAATACTATGGAGCCATAAAAGG - Intergenic
978028091 4:103902722-103902744 GAATACTACTCAGCCATGAAAGG + Intergenic
978149112 4:105413136-105413158 GAATACTATGCAGCCATAAAAGG + Intronic
978158038 4:105511572-105511594 GAATACTATTCAGCCATAAAAGG - Intergenic
978199422 4:106007842-106007864 GAATACTACGCAGCCATAAAAGG - Intergenic
978240941 4:106515482-106515504 GAATACTATGCAGCCATAAGAGG - Intergenic
978338214 4:107692802-107692824 GAATACTATGTAGCTAAAAAAGG + Intronic
978379356 4:108110813-108110835 GCTTACTAAGCAGCCATGAAGGG - Intronic
978614723 4:110583082-110583104 GAATATTATTCATCAATAAAAGG + Intergenic
978662584 4:111146420-111146442 GATTATCATTCAGCCATAAAAGG - Intergenic
978766071 4:112406283-112406305 GAATATTATTCAACCTTAAAAGG + Intronic
979031587 4:115655133-115655155 GAATACTATGCAGCCATAAAAGG + Intergenic
979174731 4:117649885-117649907 GAATACTATGTAGCCATAAGAGG + Intergenic
979182263 4:117745213-117745235 GAATACTATGAAGCCATAAAAGG - Intergenic
979202167 4:117991623-117991645 CAGTACTATGCTGGCATAAATGG - Intergenic
979597490 4:122550408-122550430 GAATACTGTATAACCATAAAAGG + Intergenic
979887532 4:126048073-126048095 GAATACTGCTCAGCCATGAAAGG + Intergenic
979914558 4:126414155-126414177 GAATATTATGCAACCAAAAAAGG + Intergenic
980239363 4:130153318-130153340 GAATACTATGCAGCCATAAAAGG - Intergenic
980460998 4:133113211-133113233 GAATACTATGCAGCATAAAGGGG + Intergenic
980672542 4:136028094-136028116 GAATACTACTTAGCCATAAAAGG + Intergenic
980702922 4:136455980-136456002 CAATACTATTTAGCCATAAAAGG + Intergenic
981266394 4:142788803-142788825 GAATACTACTCAGCCATAAAAGG - Intronic
981344206 4:143656468-143656490 GAATATTATTTAGCCATAAAAGG + Intronic
981347175 4:143689688-143689710 GAATACTATGCAGCCATAAAAGG + Intronic
981354086 4:143766762-143766784 GAATATTATTCAGCAAAAAAGGG - Intergenic
981361608 4:143852246-143852268 GAATACTACTCAGCCGTAAAAGG - Intergenic
981372343 4:143973225-143973247 GAATACTACTCAGCCATAAAAGG - Intergenic
981381427 4:144076427-144076449 GAATACTACTCAGCCATAAAAGG - Intergenic
981551916 4:145950652-145950674 CAATATTATTCAGCCTTAAAAGG + Intergenic
981825312 4:148934074-148934096 GAATACTATGCAGCCATAAAAGG + Intergenic
981877950 4:149571296-149571318 GAATACTATTCAGCCATAAAAGG + Intergenic
981983020 4:150819060-150819082 GAATATTATTCAGCAATAAAAGG + Intronic
982029915 4:151290347-151290369 GAATATTATTCAGCCCTAAAAGG + Intronic
982113611 4:152078485-152078507 GAATACTATGCAGCCATAAAAGG + Intergenic
982221955 4:153132463-153132485 GAATGTTATTTAGCCATAAAAGG - Intergenic
982311831 4:153994076-153994098 GGATACTACTCAGCCATAAAAGG - Intergenic
982361773 4:154526139-154526161 GAATATTATTCAGCCTTAAAAGG + Intergenic
982415917 4:155131835-155131857 GAATACTATGCAGCCATAAAAGG + Intergenic
982455202 4:155601579-155601601 GAATACTACTCAGCCATAAAAGG - Intergenic
982596882 4:157396706-157396728 AAATACTATTCAGTAATAAAAGG + Intergenic
982935443 4:161469260-161469282 GAATATTATACAGCCTTACAAGG - Intronic
982984962 4:162195411-162195433 ATATACTACTCAGCCATAAAAGG - Intergenic
983008044 4:162509754-162509776 GACAAATATGAAGCCATAAAAGG + Intergenic
983175232 4:164580330-164580352 GAATACTACTCAGCCATAAAAGG - Intergenic
983307902 4:166017274-166017296 AAATACTACGCAGCTATAAAAGG - Intronic
983386101 4:167063860-167063882 AAATACTATTCAGCCATAAAAGG - Intronic
983424005 4:167558852-167558874 GAATACTACTCAGCCATAAAAGG - Intergenic
983659085 4:170114157-170114179 GAATGCTATGTAGCCAAAAAAGG + Intergenic
983693017 4:170495680-170495702 GAATACTATGCATCCATAAAGGG + Intergenic
983711452 4:170722002-170722024 GAATACTCTGCAGCCAAAAAGGG + Intergenic
983827329 4:172279881-172279903 GAATACTATTCAGCCTTATGAGG + Intronic
984202456 4:176742269-176742291 GAATACTATGCGTCCGTAAAAGG - Intronic
984464135 4:180076698-180076720 GAATGCCATGCAGCCATCCATGG + Intergenic
984465595 4:180097001-180097023 GAATATTACGCCGCCATAAAAGG - Intergenic
984478653 4:180270269-180270291 GAATACTATTCAGTGATCAAAGG + Intergenic
984947407 4:184980665-184980687 GAATACTACTCACCAATAAAAGG + Intergenic
985036408 4:185844758-185844780 AAATATTATTAAGCCATAAAAGG + Intronic
985058369 4:186055658-186055680 GAATATTATTCAGCCTTAAAAGG - Intergenic
985093381 4:186387263-186387285 GAATACTATGCAGCCATAAAAGG + Intergenic
985214642 4:187637836-187637858 GAATACTATGCAATCACAAAAGG - Intergenic
985728379 5:1527536-1527558 GAATAAAATGCAACCATGAAAGG - Intergenic
985835046 5:2264304-2264326 TAATATTATGAAGCCATTAAAGG + Intergenic
985867671 5:2527939-2527961 GAATAGTATTCAGCCATGAAAGG + Intergenic
985950030 5:3215877-3215899 GAGTACTATTCAGCCATAAAAGG + Intergenic
986018261 5:3776710-3776732 GAATCCTGCGTAGCCATAAAAGG - Intergenic
986142484 5:5044018-5044040 GAATACTGTGAGGCCATAAAAGG - Intergenic
986761067 5:10880154-10880176 GAATACTATTTAGCCATAAAAGG + Intergenic
986823943 5:11500167-11500189 GGATAATATGCAGGCATAGAGGG - Intronic
987029900 5:13966174-13966196 GAATACTACTCAGCCATAAAAGG - Intergenic
987419370 5:17700724-17700746 GAATACTATGTAGCGAAAAAAGG + Intergenic
987439445 5:17938549-17938571 GAATACTATTCAGCCATAAAAGG + Intergenic
987608460 5:20170362-20170384 AAATACTATGCAGCCAAAAAAGG - Intronic
987738393 5:21873941-21873963 GAATACTATGTAGCCATAAAAGG - Intronic
988135530 5:27165767-27165789 GAATACTATACAGCCATAAAAGG - Intergenic
988184963 5:27848012-27848034 GAATACTACTCAGACACAAAAGG - Intergenic
988647519 5:33110455-33110477 GAATACTATGTAACCATAAAAGG - Intergenic
988729774 5:33960414-33960436 GAATACTACTCAGCCATAAAAGG + Intronic
988830728 5:34984550-34984572 GAATATTATTCAACCTTAAAAGG - Intergenic
989065407 5:37455935-37455957 GAGTACTACACAGCTATAAAAGG - Intronic
989278857 5:39619421-39619443 GAATGCTACTCAGCCATAAAAGG + Intergenic
989304674 5:39939689-39939711 TAATACTACTCAGACATAAAAGG - Intergenic
989516120 5:42346167-42346189 GAATATTATTCATCCCTAAAAGG + Intergenic
989722453 5:44545678-44545700 GAATACTATGTAGCCATAAAAGG + Intergenic
989772048 5:45156695-45156717 GAATACTATGCAGCCAAAAAAGG + Intergenic
990077589 5:51869786-51869808 AAACACTATGCAGCAATAAATGG - Intergenic
990083731 5:51949025-51949047 GAATATTATCCAGCCATAAAAGG + Intergenic
990269890 5:54125509-54125531 GAATATTATTCATCCATAAAAGG - Intronic
990882174 5:60551361-60551383 GAATATTACTCAGCTATAAAAGG + Intergenic
991048881 5:62251727-62251749 GAAGACTGTGCATTCATAAATGG + Intergenic
991268928 5:64756501-64756523 GAATATTATTCAGCCATAAAAGG - Intronic
991279823 5:64899998-64900020 GAATACTACTTAGCAATAAAAGG - Intronic
991313933 5:65278163-65278185 GAATACTACTCAGCCATAAAGGG - Intronic
991558889 5:67927805-67927827 GAATACTCTTCAGCAAAAAAAGG - Intergenic
991995395 5:72381455-72381477 GAAAACTATAAATCCATAAATGG + Intergenic
992062785 5:73072557-73072579 GAATATTATTCAGCCTTAAAAGG + Intronic
992291187 5:75281758-75281780 GAATACTGTGCAACTTTAAAAGG - Intergenic
992339600 5:75808967-75808989 GAATACTACTCAGCCATAAAAGG - Intergenic
992662986 5:78979950-78979972 GAATATTATTGAGCCATAAAAGG + Intronic
993108145 5:83623562-83623584 GAATATTATTCAGCCTTAAGAGG + Intergenic
993212638 5:84973854-84973876 GAATACTACTCTGCCATAAAAGG - Intergenic
993219985 5:85081483-85081505 GAATACTACGCAGCAATAAAAGG - Intergenic
993365004 5:87024500-87024522 AAATACTATGCAGCCATAAAAGG - Intergenic
993544465 5:89194319-89194341 GAATATTATGCAGCCATAAAAGG - Intergenic
993601241 5:89927714-89927736 GAATACTACTCAGCCATAAAGGG + Intergenic
993652617 5:90540492-90540514 GAGTATTATTCAGCCGTAAAAGG + Intronic
993974421 5:94459159-94459181 GAATATTATTCAGTAATAAAGGG - Intronic
994050859 5:95360363-95360385 GAATACTACTCAGCCTAAAAAGG - Intergenic
994323221 5:98417487-98417509 GAATACTACTCAGCAATAAAAGG + Intergenic
994419221 5:99511750-99511772 GAGTACTACACAGCTATAAAAGG - Intergenic
994437558 5:99758222-99758244 GAATACTGTGCAGCCATAAAAGG - Intergenic
994445916 5:99873822-99873844 GAATACTATGCAGCCACAAAAGG + Intergenic
994511900 5:100714548-100714570 GAATATTATGCAGCCATAAAAGG - Intergenic
994515968 5:100773415-100773437 GAAAATGATGAAGCCATAAATGG - Intergenic
994731776 5:103500019-103500041 GAATACTATGCAGTAATATCAGG + Intergenic
994777694 5:104055695-104055717 GAATACTACTCATCCATAAAAGG - Intergenic
995095416 5:108230375-108230397 GAATATTTCTCAGCCATAAAAGG + Intronic
995175994 5:109177736-109177758 GATTACTCGGCAGACATAAATGG + Intronic
995257790 5:110066963-110066985 GAATACTATGCAGACATAAGAGG - Intergenic
995295085 5:110511099-110511121 GACTACTATGCCGCCACAAAAGG + Intronic
995695293 5:114872513-114872535 GAATACTATGCAGCCATAAAAGG + Intergenic
995919439 5:117293848-117293870 GAATACTATGCAGCCATAAAAGG - Intergenic
995959106 5:117817678-117817700 GAATACTATGCAGCCATAAAGGG - Intergenic
996128772 5:119755614-119755636 GAATACTACTCAGCCATAAAAGG + Intergenic
996204442 5:120714794-120714816 GAATACTATCCAGCATAAAAAGG + Intergenic
996269805 5:121589598-121589620 AAATACTATTCAGCCTTAAAAGG + Intergenic
996269988 5:121592536-121592558 GAATACTATGCAGCCATAAAAGG + Intergenic
996290773 5:121850494-121850516 GAATACTACTCAGCAATAAAAGG + Intergenic
996385748 5:122908743-122908765 GAATATTATGTAGCAGTAAAAGG + Intronic
996422054 5:123273239-123273261 GAATGCTATGCAGCTGTTAATGG - Intergenic
996635409 5:125683098-125683120 GAATACTATGAAGACATTAAGGG + Intergenic
996676953 5:126187159-126187181 GAGTATTATTCAGCCTTAAAAGG + Intergenic
996894352 5:128461656-128461678 GAATACTATGCAACCATAAAAGG + Intronic
996997964 5:129721937-129721959 GAATACTATGCAGCCATAAAAGG - Intronic
997116571 5:131131859-131131881 GAAGACTATACTCCCATAAAAGG + Intergenic
997270754 5:132535759-132535781 GAAAACTAGGCAGGCAAAAAGGG + Intergenic
997403664 5:133624252-133624274 GAATATTATTTAGCCACAAAAGG + Intergenic
997485944 5:134230830-134230852 GAATACTATCCAGACATCAGGGG - Intergenic
997556137 5:134800417-134800439 GAATATTATTCAGCAATAAAAGG - Intronic
997612126 5:135222663-135222685 GGATACTATGGAGCCATCATAGG - Intronic
997663155 5:135604752-135604774 GAATATTACGGAGTCATAAAAGG + Intergenic
997945200 5:138194132-138194154 GAATACTACTCAGCAATAAAAGG + Intronic
998062574 5:139130777-139130799 GAATATTATTCAGCCATAAAAGG + Intronic
998511044 5:142714136-142714158 GAATATTATTCACCCCTAAAAGG - Intergenic
998725422 5:145007599-145007621 GAATATTATTCAATCATAAAAGG + Intergenic
998742089 5:145215582-145215604 GAATACTACTCAGCCATACCAGG + Intergenic
998746579 5:145266836-145266858 GAATACTACTCAGCCAACAAAGG + Intergenic
998773625 5:145573685-145573707 GAATACTATGCAGCCATAAAAGG - Intronic
999020273 5:148157931-148157953 GAATACTATGCAGCAAATGAAGG - Intergenic
999123130 5:149225495-149225517 GAATATTGTTCAGCCATAAAAGG - Intronic
999186134 5:149710736-149710758 GAATACTACTCAGCAATAAAAGG - Intergenic
999235656 5:150091418-150091440 GAATATTATTCAGCTATAAAGGG + Intronic
999411480 5:151353902-151353924 GAATATTATTCAGCATTAAAAGG - Intergenic
999528330 5:152433319-152433341 AAATACTACTCAGCAATAAAAGG + Intronic
999574159 5:152955453-152955475 GAATACTATGCAACCATAAAAGG - Intergenic
999581199 5:153040295-153040317 CAATACTACACGGCCATAAAAGG + Intergenic
999587422 5:153106204-153106226 GAACACTATTCAGCCTTAAGAGG + Intergenic
999760595 5:154697564-154697586 GAATGTTATTCAGCCATAACAGG + Intergenic
999831721 5:155326575-155326597 GAATACTATGCAGCCATAAAAGG + Intergenic
999880445 5:155857438-155857460 AAATACTAAGCAGCAATGAAAGG + Intergenic
1000293498 5:159892670-159892692 GAATACTATGCAGCCGTAAAAGG - Intergenic
1000367152 5:160502241-160502263 GAATACAACTCAGCCATAAAAGG - Intergenic
1000550807 5:162661014-162661036 AAATACTATTGAGTCATAAAAGG - Intergenic
1000861674 5:166463175-166463197 GAATACTACTCAATCATAAAAGG - Intergenic
1001747331 5:174101631-174101653 GAATGTTATTCAGCCATGAAAGG - Intronic
1002004737 5:176222819-176222841 GAATACTATTAAGAAATAAAAGG + Intergenic
1002150823 5:177229114-177229136 GAATACTATTTAGCAAAAAAGGG - Intronic
1002336438 5:178482252-178482274 GAATATTATTCAGCCTTAAATGG + Intronic
1002413888 5:179107800-179107822 GACTACTACTCAGTCATAAAAGG + Intergenic
1002707570 5:181172941-181172963 GAATACTACATACCCATAAATGG + Intergenic
1002734094 5:181369801-181369823 GAATACTACTCAGCCTTAATAGG - Intergenic
1002750447 6:104325-104347 GAATACTACTCAGCCTTAATAGG + Intergenic
1002853249 6:1015403-1015425 GAATACTATGCAGCCATAAAAGG + Intergenic
1002996777 6:2293894-2293916 GAAAACTATGCATCCAACAAAGG + Intergenic
1003090895 6:3102121-3102143 GAATGTTATTCAGCCATAAAAGG - Intronic
1003201150 6:3961921-3961943 GAATACTACTCAGCAGTAAAAGG + Intergenic
1003376734 6:5585654-5585676 GACTATTATTCAGCCACAAAAGG - Intronic
1003428436 6:6015619-6015641 GAATATTATACTGCCTTAAAAGG - Intergenic
1003433573 6:6063992-6064014 GAATATTGTGCAGCCATAAAAGG - Intergenic
1004046471 6:12029035-12029057 GAATATTATGTAGCGATAAAAGG - Intronic
1004183718 6:13403675-13403697 GAAATATATTCAGCCATAAAAGG + Intronic
1004654205 6:17642837-17642859 GAATATTATTCAGCCATAAAAGG + Intronic
1005031768 6:21515439-21515461 GAATAATATGCAGCGACTAAAGG + Intergenic
1005453344 6:25995026-25995048 GAATATTATAAAGCAATAAAAGG - Intergenic
1005519835 6:26589577-26589599 GAATACTGCTCAGCAATAAAAGG - Intergenic
1005564477 6:27076939-27076961 GAATACTATTCATCAATAAAAGG - Intergenic
1005581992 6:27244152-27244174 GAATATTATTCAGCCATAAAAGG + Intergenic
1005584803 6:27266107-27266129 GAATATTATTCAGCCTTGAAAGG + Intergenic
1005839743 6:29735000-29735022 GAATATGATTTAGCCATAAAAGG - Intronic
1006256163 6:32834289-32834311 GAATATTATTCAGCCTTAAAAGG + Intronic
1006306014 6:33219250-33219272 GAATACTATGCAGCCATAAAAGG - Intergenic
1006978777 6:38128668-38128690 GAGTAATACTCAGCCATAAATGG - Intronic
1007157662 6:39761536-39761558 GAATAGTATGCAGCCATAAAAGG - Intergenic
1007188084 6:39989641-39989663 GAATACTATGTAGCCATAAAAGG - Intergenic
1007194222 6:40046479-40046501 GAATATTGTTCAGCCTTAAAAGG + Intergenic
1007299803 6:40858347-40858369 GAATACTACTCAGCCATAAATGG - Intergenic
1007344569 6:41218607-41218629 GAATACTATGCACCAAAAAAAGG + Intergenic
1007859372 6:44891403-44891425 GAAGATTATTCAACCATAAAAGG + Intronic
1008006121 6:46411172-46411194 GAATATTATTCAGCCTTAAGAGG + Intronic
1008298932 6:49810540-49810562 GAATACTATGCAGCCACAAAAGG + Intergenic
1008324800 6:50165226-50165248 GAATATTACGTAGCCATAAAAGG - Intergenic
1008387476 6:50909153-50909175 GAATATTATTTAGCAATAAAAGG - Intergenic
1008637854 6:53429832-53429854 GAATACTACTCAGTCACAAAAGG + Intergenic
1008643304 6:53486839-53486861 GAATACTACTCAGCAACAAAAGG - Intergenic
1009326183 6:62350386-62350408 GAATACTATTCATCAATGAAAGG + Intergenic
1009394088 6:63177264-63177286 AAATACTATGCAGCCATAAAAGG - Intergenic
1009422651 6:63481025-63481047 GAATACTACTCAACCATGAAAGG + Intergenic
1009500707 6:64409132-64409154 GAATACTATGCAGCCATAAAAGG - Intronic
1009558600 6:65208605-65208627 GAATACTATTCAGCCATAAAAGG + Intronic
1009976024 6:70671808-70671830 GAATATTATTCAGCCATAAAAGG - Intronic
1010117201 6:72328111-72328133 GAATACTATGCAGCCATAAAAGG + Intronic
1010306122 6:74324877-74324899 GAATACTATGCAGCCATAAAAGG + Intergenic
1010416660 6:75619412-75619434 GAATGTTATTCAGCCTTAAAGGG - Intronic
1010485505 6:76407711-76407733 GAATAGTATTCAGCTACAAAAGG - Intergenic
1010520055 6:76821544-76821566 AAATACTATGCAACCATAAAAGG - Intergenic
1010663863 6:78602828-78602850 GAATACTATGCAGCCAAAAAAGG - Intergenic
1010736300 6:79447586-79447608 GAATGTTATTCAGCCATTAAAGG + Intergenic
1010742157 6:79520741-79520763 TAATACTATGAAGCTATTAAAGG + Intronic
1010757104 6:79678471-79678493 GAATATTATGCAGTCTTAATAGG - Intronic
1011190531 6:84723330-84723352 GAATATTATTCAGCTTTAAAAGG - Intronic
1011203854 6:84869987-84870009 GAATACTACTCAGCAATAAGGGG - Intergenic
1011453435 6:87520651-87520673 GAATACCACTCAGCAATAAAAGG + Intronic
1011464721 6:87643449-87643471 GAAAACAATGAAGCCATCAAAGG + Intronic
1011567952 6:88699721-88699743 GAACATTATTCAGCCTTAAAAGG + Intronic
1011747847 6:90423968-90423990 GAATATTACTCAGCAATAAAAGG - Intergenic
1011833356 6:91401259-91401281 GAATACTATGTAGCCATAAAAGG - Intergenic
1011858423 6:91724325-91724347 AAATACTATGCAGCCATAAAAGG - Intergenic
1011896921 6:92239256-92239278 GAATACTACTCAGCCATAAAAGG - Intergenic
1011910117 6:92425444-92425466 GAATACTGTGCAGCCATAAAAGG + Intergenic
1011928655 6:92681142-92681164 GAATATTATGTAACCATTAAAGG + Intergenic
1011994250 6:93565438-93565460 GAATACTAAGCAGCCATAAAAGG - Intergenic
1012121603 6:95374446-95374468 GAATACCATGCAGCTATAAAAGG + Intergenic
1012143620 6:95653859-95653881 GAATACTAATCAACTATAAAGGG + Intergenic
1012225248 6:96695894-96695916 GATTACTACTCAGCCATAAAAGG + Intergenic
1012457995 6:99428440-99428462 GAATATTATTCAGCCTTAAAAGG + Intergenic
1012590765 6:100977474-100977496 GAATACTATGCAGCCATAAAAGG + Intergenic
1012614339 6:101258157-101258179 GAATACCATTCAGCAATAAAAGG + Intergenic
1012785397 6:103618584-103618606 GAATACTAGGCAGCCCTTAAAGG - Intergenic
1012830440 6:104197989-104198011 GCAAACTATGCATCCATCAAAGG + Intergenic
1012914952 6:105160088-105160110 GTATAATATGCACACATAAATGG - Intronic
1013011414 6:106124125-106124147 GAATACTACCCAGACATTAAAGG + Intergenic
1013263869 6:108474219-108474241 GAATACTCTGCAGCCAGAAAAGG - Intronic
1013453516 6:110308752-110308774 GAATATTATTCAGCCATAAAAGG + Intronic
1013590377 6:111614852-111614874 GAATATTATTCAGCCTTAAAAGG + Intergenic
1013875802 6:114826154-114826176 GAATGCTGTGCTGCCATAGAGGG - Intergenic
1013926171 6:115475369-115475391 GAATTCTATGCAGCCATAAAAGG - Intergenic
1014280214 6:119434237-119434259 GAATATTATTCAGCTTTAAAAGG + Intergenic
1014292000 6:119569800-119569822 GAATATTATTTAGCCATAAAAGG + Intergenic
1014312896 6:119827704-119827726 GAATACTACTCAGCCATAAAAGG - Intergenic
1014465451 6:121751071-121751093 GAGTACTATGCATCCGTAAAAGG - Intergenic
1014650606 6:124032069-124032091 GAATACTATGCAGCCATGAAAGG + Intronic
1014720611 6:124913220-124913242 GAATATGATTCAGCCTTAAAAGG - Intergenic
1014859113 6:126441789-126441811 GAATACTACTCAGCCCTGAAAGG - Intergenic
1014860180 6:126456789-126456811 GCAAACTATGCAACCATCAAAGG + Intergenic
1014893945 6:126877151-126877173 GCATATTATTCAGCCAAAAAAGG - Intergenic
1014917317 6:127167458-127167480 GAATATTATGCAGCCATAAAAGG - Intronic
1015455831 6:133425045-133425067 GAATACTGCTCAGCAATAAAAGG - Intronic
1015607737 6:134976557-134976579 GAATACTACTCAGCCATACAAGG + Intronic
1015734340 6:136381728-136381750 GAATACTAAGCAGAAATAATAGG - Intronic
1015860280 6:137670196-137670218 GAATACTATGCAGCAATAAAAGG - Intergenic
1016080049 6:139844945-139844967 GAATACTATGCAACATAAAAAGG + Intergenic
1016678288 6:146797571-146797593 GAATACTACTCAGCCATAAAAGG + Intronic
1016693024 6:146961179-146961201 GAATAGTATTCAGCCATAACTGG + Intergenic
1016697455 6:147014578-147014600 GAATACTACTCAGCAATAAAAGG + Intergenic
1016729434 6:147412694-147412716 GAATATTATTCATCCTTAAAAGG + Intergenic
1016734605 6:147463258-147463280 GAATATTATTCAGCAATAAAAGG - Intergenic
1016781556 6:147964872-147964894 GAATATTATTCACCCATAAAAGG - Intergenic
1016983881 6:149879632-149879654 GCAAACTATGCAGCCAACAAAGG + Intergenic
1017138519 6:151169354-151169376 GAATACTACTCAGCCATAAAAGG + Intergenic
1017390617 6:153935061-153935083 GAATACTATGCAGGCATAAAAGG - Intergenic
1017963373 6:159242138-159242160 GAATACTATGCAGCCATAAAAGG + Intronic
1018104498 6:160469974-160469996 GCATACTATTCAGCAATAAAAGG - Intergenic
1018112728 6:160550875-160550897 GCATACTGTTCAGCAATAAAAGG - Intronic
1018224685 6:161616745-161616767 GAATACTTTGCAGCCTTAAGGGG - Intronic
1018279172 6:162166194-162166216 AAATACTTCTCAGCCATAAAAGG + Intronic
1018326720 6:162678140-162678162 GAATACTATTTAACAATAAAAGG - Intronic
1018600250 6:165530373-165530395 GCAAACTATGCATCCAAAAAAGG + Intronic
1019238342 6:170642115-170642137 GAATACTACTCAGCCTTAATAGG - Intergenic
1019362034 7:609721-609743 GAATACTAGGCAGCTGTAAAAGG - Intronic
1019851895 7:3567746-3567768 GAATGTTATGCAGCCATCAAAGG - Intronic
1019863223 7:3680088-3680110 GAATCCTTTGCGGCAATAAAAGG + Intronic
1019967256 7:4509840-4509862 GAACACTATGTAGCCATAAAAGG + Intergenic
1019972765 7:4554792-4554814 GAATACTATGTAGCCACAAAAGG - Intergenic
1020041083 7:5002149-5002171 TAATATTATTCAGCCTTAAAAGG - Intronic
1020407237 7:7851244-7851266 GAATATTATACAACAATAAAAGG - Intronic
1020459043 7:8407294-8407316 GAATACTATTCTCCAATAAAAGG - Intergenic
1020509965 7:9042838-9042860 GAATACCACTCAGCAATAAAAGG - Intergenic
1020510636 7:9052698-9052720 GAATATTATTCAGCTTTAAAAGG - Intergenic
1020607945 7:10361271-10361293 AAATACTATGCAGCCAAAAAAGG + Intergenic
1020633291 7:10666813-10666835 GAATACTATGCAGTCATAAAAGG - Intergenic
1020852047 7:13366289-13366311 GAATACGATGCAACCATAAAAGG - Intergenic
1020865094 7:13550184-13550206 GAGTACTACTCAGCCATAGAAGG + Intergenic
1021010148 7:15452878-15452900 GAATATTAGCAAGCCATAAAAGG + Intronic
1021045200 7:15914281-15914303 AAATACTACTCAGCCATAAAAGG + Intergenic
1021176484 7:17455964-17455986 AAATACTAATCAGCCATAAAAGG + Intergenic
1021354661 7:19639228-19639250 GAATACTATGCAGCATAAAAAGG - Intergenic
1021371877 7:19859384-19859406 ATATACTATGAAGCCATAAGAGG + Intergenic
1021442705 7:20696217-20696239 AAATGCTATGCAGCAATAAAAGG + Intronic
1021506228 7:21388573-21388595 GAATATTATTCAGCACTAAAAGG - Intergenic
1021603308 7:22386220-22386242 GAATATTATTCAGCCTTAAAAGG - Intergenic
1021652399 7:22844846-22844868 GAACACAATTCAGCCATAATAGG + Intergenic
1021705984 7:23368207-23368229 GAATATTATTCAACCATAAAAGG + Intronic
1021778423 7:24076769-24076791 GAACACTATTCAGCCACAAAAGG - Intergenic
1022022280 7:26412378-26412400 GAATAGTATGCAGCCATTGGAGG - Intergenic
1022324084 7:29314195-29314217 GAATGTTATTCAGCCTTAAAAGG + Intronic
1022449405 7:30501088-30501110 GGATACTCTACAGACATAAAAGG - Intronic
1022876658 7:34540028-34540050 GAATACTATCCAGCCACAAAAGG - Intergenic
1023219019 7:37899336-37899358 GAATACTATGCAGCCATAAAAGG + Intronic
1023276078 7:38519930-38519952 GAATACTATGCAGCCATAAAAGG + Intronic
1023385694 7:39655234-39655256 GAATACTACTCAGCAATAAAAGG + Intronic
1023499897 7:40836792-40836814 GAATACTATCCAGCAATGAAAGG - Intronic
1023509819 7:40939782-40939804 GCAAACTATGCATCCAAAAAAGG - Intergenic
1023643633 7:42286790-42286812 CAATACTACTCAGCAATAAAAGG + Intergenic
1024452897 7:49568854-49568876 GAATACTACACAGACATAAAAGG + Intergenic
1024477367 7:49828204-49828226 GAATACTACTCAGCCAAAAAAGG - Intronic
1024833311 7:53486993-53487015 GAATACTACTCAGCTATAAAAGG - Intergenic
1024916762 7:54509988-54510010 GCATACTACGCAGCCATAAAAGG - Intergenic
1025113921 7:56241636-56241658 GAATACTACACAGCCATAAAAGG - Intergenic
1025225504 7:57157315-57157337 GAACATTATGTAGCCTTAAAAGG + Intergenic
1025795011 7:64731517-64731539 GAATACTATTCAGTCTTAAAAGG - Intergenic
1025807967 7:64853574-64853596 GAATACTATTCAGCCTTCAAAGG - Intergenic
1025908355 7:65807392-65807414 GAATATTATTCAGCCATAGAAGG - Intergenic
1025924939 7:65950691-65950713 AAATACTATGTAGCCATTAAAGG + Intronic
1025980770 7:66403621-66403643 GAATATTATTCAGCCATAGAAGG + Intronic
1026164307 7:67896435-67896457 GAATATTACTCAACCATAAAAGG - Intergenic
1026453234 7:70547643-70547665 GAATACTATTCAGCAATTAACGG - Intronic
1026512690 7:71040069-71040091 GAATATTATTCAGCCTTAAAGGG - Intergenic
1026811980 7:73475375-73475397 GAATATTATCCAGCCATAAAAGG + Intronic
1027142839 7:75671406-75671428 GAATGTTATTCAGCCTTAAAAGG - Intronic
1027191529 7:75999254-75999276 GAATATTATTCAGCCTTAAAAGG + Intronic
1027349874 7:77300477-77300499 GAATACTACTCAGCCATAAAAGG - Intronic
1027425352 7:78056473-78056495 GAATACTATGCAGCCATAAAAGG + Intronic
1027557457 7:79683764-79683786 GGATACTATTCAGTGATAAAAGG - Intergenic
1027566095 7:79796656-79796678 GAATACTGTTCAGCAACAAAAGG + Intergenic
1027610740 7:80357491-80357513 GAATATTATTCATTCATAAAAGG + Intergenic
1027697763 7:81432657-81432679 GTATACTATGGAGCTATATAGGG + Intergenic
1027987934 7:85318644-85318666 GAATATTATGTAGACTTAAAAGG + Intergenic
1028044209 7:86094850-86094872 GAATACTATGCAGCCATGAGAGG + Intergenic
1028609033 7:92687968-92687990 GAATACTACACAGCAATGAAAGG - Intronic
1028632134 7:92946608-92946630 GAATATTATTCAGCCTTAAAAGG - Intergenic
1028887042 7:95945958-95945980 GAATACTATGCAGCCATAAAAGG + Intronic
1028935688 7:96461690-96461712 GAATATTATTTAGCCAGAAAAGG - Intergenic
1028977536 7:96931001-96931023 GAATACTAGGCAGCCAAAAAGGG + Intergenic
1029092781 7:98061292-98061314 GAATACTATTCAGCCACAAAAGG - Intergenic
1029167632 7:98604895-98604917 GAATACTACACAGTAATAAAAGG - Intergenic
1029324414 7:99793755-99793777 GAATATTATTCGGCCATAAATGG - Intergenic
1029879478 7:103792373-103792395 GAATATTATTCAACCATAAATGG + Intronic
1029883931 7:103847223-103847245 GAATACTATGCAGCCATAAAAGG + Intronic
1030184411 7:106746830-106746852 GAATATTATTCAGCCACAAAAGG + Intergenic
1030185101 7:106753938-106753960 ATATACTATTCAGCCTTAAAAGG - Intergenic
1030418059 7:109270374-109270396 GAATAGTATTTAGCCATAAAAGG - Intergenic
1030485962 7:110167917-110167939 CAATACTAAATAGCCATAAAAGG - Intergenic
1030536877 7:110778787-110778809 AAATACTATTCAGCTATAAGTGG + Intronic
1030582568 7:111376700-111376722 GAATATTATTAAGACATAAAAGG + Intronic
1030756925 7:113297271-113297293 GAATACTGTTTGGCCATAAAAGG + Intergenic
1031186497 7:118487588-118487610 GAATACTACTCAGCCATAAAAGG + Intergenic
1031741119 7:125432371-125432393 GATTGTTATTCAGCCATAAAAGG + Intergenic
1031747420 7:125519075-125519097 AAATATTATTCAGCCTTAAAAGG - Intergenic
1031874717 7:127125705-127125727 GAAAACTATGCATCCATCAGGGG + Intronic
1032112283 7:129086373-129086395 AAATATTATTCAGCCATAAAAGG + Intergenic
1032227620 7:130045956-130045978 TGATACTATGCAGCCATAAAAGG + Intronic
1032317256 7:130849943-130849965 GAATATTATTCAGCCATTAAAGG - Intergenic
1032378187 7:131445635-131445657 GAGTACTATGCTGGAATAAAAGG - Intronic
1032628490 7:133620608-133620630 GAATATTATTCTTCCATAAAAGG + Intronic
1032857962 7:135852147-135852169 GAATACTACGCAGCCATAAAAGG - Intergenic
1032892301 7:136210574-136210596 GGATACTACTCAGCAATAAAAGG + Intergenic
1032926248 7:136608513-136608535 GAATACCATACAGCCATAAAAGG - Intergenic
1032942045 7:136804932-136804954 AAATAGTATTCAGCTATAAAAGG + Intergenic
1032944839 7:136837443-136837465 AAGTACTATTCAGCAATAAATGG + Intergenic
1033349392 7:140549927-140549949 GAATATTATTCAGCCACAAAAGG + Intronic
1033429160 7:141273030-141273052 GAATATTATTTAGCCATAAAAGG + Intronic
1033447341 7:141434944-141434966 GAATACTATTCTGCCATGAAAGG - Intronic
1033623362 7:143083302-143083324 AAATACTATTCAGCCATAAAAGG + Intergenic
1033764342 7:144471864-144471886 GAATACAATGCATCCATGGATGG + Intronic
1034031182 7:147765871-147765893 GAATACTACCCAGCCAAAAAAGG + Intronic
1034216621 7:149412435-149412457 GCAAACTATGCATCCATCAAAGG + Intergenic
1034310724 7:150085300-150085322 GAATACAATGCATCCAGAAGAGG + Intergenic
1034705042 7:153134188-153134210 GAATACTACTCAGCCACAAAAGG - Intergenic
1034711393 7:153194432-153194454 AAATACTATTCAGCAATAAATGG + Intergenic
1034796117 7:154015331-154015353 GAATACAATGCATCCAGAAGAGG - Intronic
1035509427 8:164492-164514 GAATACTACTCAGCCTTAATAGG + Intergenic
1035520107 8:268972-268994 GAATACTATGCAGCCATAAAAGG + Intergenic
1036093136 8:5691065-5691087 GAATACTATGCAGTCATAAAAGG - Intergenic
1036095662 8:5722555-5722577 GAATACTACTCAGCAATAAATGG + Intergenic
1036165242 8:6426527-6426549 GAATACTACTCAGCTATAAAAGG - Intronic
1036510973 8:9399967-9399989 GAATATTATTCAGCCTTAAAAGG + Intergenic
1036559106 8:9886375-9886397 GAATATTATTCAACCTTAAAAGG - Intergenic
1036584870 8:10114149-10114171 GATTATTATTCAGCCATAAAAGG - Intronic
1036603330 8:10283774-10283796 GAATACTACTCAACCAAAAAAGG - Intronic
1036919047 8:12833990-12834012 GAATACTATGCAGCCTTAAAAGG - Intergenic
1037026919 8:14050237-14050259 GGATACTACGCAGCCGTAAAAGG - Intergenic
1037032546 8:14126789-14126811 GAATACTATGCAGCCATAAAAGG + Intronic
1037135885 8:15459806-15459828 GAATACTACTTAGCCATAAAAGG - Intronic
1037220065 8:16508067-16508089 CAATACTATGCAACCATAAAAGG + Intronic
1037301891 8:17460672-17460694 GAACACTATTCATCAATAAAAGG + Intergenic
1037357861 8:18041691-18041713 GAATATTATTCAGCAATACAAGG - Intergenic
1037369153 8:18155125-18155147 GAATACTATTCAACTATAAAAGG + Intergenic
1037370259 8:18169829-18169851 GAATATTATTGAGCCTTAAAAGG + Intergenic
1037461895 8:19118956-19118978 AAATACTATCCAGCCATAAATGG - Intergenic
1037531894 8:19784507-19784529 GAATACTATGCAGCCATAAAAGG + Intergenic
1037650824 8:20836939-20836961 GAAATCAAGGCAGCCATAAAAGG - Intergenic
1037854305 8:22359850-22359872 GAATATTATTCAGCACTAAAAGG + Intergenic
1038121699 8:24624104-24624126 GAATACTACTCAGCCATAAAAGG + Intergenic
1039000762 8:32977416-32977438 GAGTACTACTCAGCCATAGAAGG - Intergenic
1039030813 8:33307487-33307509 GAATACTATTCAGCCATAAAAGG + Intergenic
1039132575 8:34284015-34284037 GAATACTACTCAACCATAAAAGG - Intergenic
1039293335 8:36122274-36122296 GAATACTATGCTGCCTAAAAAGG - Intergenic
1039367175 8:36941581-36941603 GAATATTATGTAACAATAAAGGG + Intergenic
1039410131 8:37347915-37347937 GAATACTAGTCAGCAATAAAAGG + Intergenic
1039537758 8:38334161-38334183 CTATACTATATAGCCATAAATGG + Intronic
1039581309 8:38669029-38669051 GAATACTATGCAGCCATAAAAGG + Intergenic
1039674070 8:39640365-39640387 CAATACTATGCAGCCATAAAAGG - Intronic
1040027090 8:42791772-42791794 GAATACTATTCAGCCATAAAAGG - Intronic
1040090219 8:43391026-43391048 GAATACTACACAACCATAAAAGG - Intergenic
1040090986 8:43398582-43398604 GCATACTATGCAGCCATAAAAGG - Intergenic
1040457620 8:47614531-47614553 GAATACTATGCAGCCATAAAAGG - Intronic
1040617335 8:49050112-49050134 GCAAACTATGCATCCAAAAAAGG - Intergenic
1040714639 8:50235248-50235270 GAATACTACTCTGTCATAAAAGG + Intronic
1040809858 8:51440083-51440105 GAATACTACTCAGCCATAAAAGG + Intronic
1040887466 8:52281699-52281721 GAATACAACTCAGCCATAAAAGG + Intronic
1040989301 8:53332378-53332400 GAATATTGTTTAGCCATAAAAGG - Intergenic
1041014013 8:53572656-53572678 GAGTACTATGCAGCTGTGAAAGG - Intergenic
1041112966 8:54504720-54504742 GAGTACTATGCAGCCATAAAAGG + Intergenic
1041180726 8:55245281-55245303 GCAAACTATGCATCCATCAAAGG - Intronic
1041555753 8:59153200-59153222 GAATATTATTCAGCACTAAAAGG - Intergenic
1041687488 8:60657747-60657769 AAATATTATTCAGCCTTAAAAGG + Intergenic
1041747094 8:61219484-61219506 GACTACTATGCAGCTGTAAAAGG - Intronic
1041796023 8:61749605-61749627 GAATACTATTCAGCTTTAAAAGG - Intergenic
1041854127 8:62430187-62430209 GGATATTATTCAGCCTTAAAAGG - Intronic
1041911788 8:63096870-63096892 AACTATTATTCAGCCATAAAAGG - Intergenic
1042082719 8:65072507-65072529 GAAGACTATTCAGCAACAAAAGG + Intergenic
1042240372 8:66658043-66658065 TAATAATATGCAGCCAGACACGG + Intronic
1042306087 8:67334711-67334733 GAATGCTATTCATCAATAAAAGG + Intronic
1042342689 8:67696666-67696688 GAATACCACTCAGCAATAAAGGG + Intronic
1042400390 8:68338669-68338691 GAATACAACTCAGCAATAAAAGG - Intronic
1042773125 8:72400367-72400389 CAATATTATGCAGCCCTAGAAGG - Intergenic
1042839978 8:73113827-73113849 GAGTACTATTCAGCCAAAAAAGG - Intronic
1042980975 8:74527572-74527594 GAGTACTATTCAGCCATAAAAGG - Intergenic
1043116533 8:76261173-76261195 GAATACTATTCAACCATAAAAGG + Intergenic
1043166888 8:76914067-76914089 GAATATTATGCAGTTCTAAATGG + Intergenic
1043221440 8:77670905-77670927 GAATACTATGCAGCCATAAAAGG + Intergenic
1043224258 8:77702645-77702667 GAATATTATTCAGCCTTACAAGG - Intergenic
1043237419 8:77885538-77885560 AAATACAATGCAGTTATAAATGG + Intergenic
1043285395 8:78522068-78522090 AAATAGTATTCAGCCTTAAAAGG - Intronic
1043329369 8:79095482-79095504 GAATACTACTCAGCAAGAAAAGG + Intergenic
1043348938 8:79335891-79335913 GAATACTACCCAGCCATAAAAGG + Intergenic
1043455049 8:80404575-80404597 GAATACTACTCAACCATGAAAGG + Intergenic
1043508117 8:80922825-80922847 GAGTATTATTCAGCCATAAAAGG + Intergenic
1043636621 8:82391891-82391913 AAACACTACTCAGCCATAAAAGG - Intergenic
1043868826 8:85406531-85406553 AAATACTATTCTGTCATAAAGGG + Intronic
1043916798 8:85932221-85932243 CAATATTATGCAGCCTTAAAAGG + Intergenic
1043951486 8:86314224-86314246 GAATGCTATGCAGCCATGCATGG - Intronic
1044002088 8:86895300-86895322 AAATATTATTCAGCAATAAAAGG - Intronic
1044059648 8:87619914-87619936 GAATATTATGCAGCAATTAGAGG + Intergenic
1044194229 8:89354966-89354988 GAATACTGCTCAACCATAAAAGG + Intergenic
1044207156 8:89503763-89503785 GAACACTATGTAGCCATAAAAGG - Intergenic
1044272411 8:90262092-90262114 GAATACTATTTAGCAATAAAAGG + Intergenic
1044468237 8:92533379-92533401 GAATACTATTTAGCTATAAAAGG + Intergenic
1044873186 8:96640276-96640298 GAGTACTATGCAGCCATAAAAGG + Intergenic
1044885142 8:96768991-96769013 AATTACTATGCAGCAATAATGGG - Intronic
1045045584 8:98273166-98273188 GAAGATTATTCAGCCATAAAAGG + Intronic
1045088872 8:98717850-98717872 GAATTTTATTCAGCCTTAAAAGG + Intronic
1045095790 8:98796698-98796720 GCAAACTATGCAGCCGTCAAAGG + Intronic
1045101452 8:98848687-98848709 GAATATTATCCAGCAATAAAAGG - Intronic
1045156179 8:99474995-99475017 TAATACTAATCAGCCATTAAAGG + Intronic
1045466415 8:102474759-102474781 GAATACTACTCAGCAATAAAAGG + Intergenic
1045587431 8:103554279-103554301 GCATACTATGCATCCAGCAAAGG + Intronic
1046010854 8:108545231-108545253 GAATATTATTCAGCAATAAAAGG - Intergenic
1046065658 8:109194102-109194124 GAATATTATTCAGCACTAAAAGG - Intergenic
1046145289 8:110150218-110150240 GAATACTATGCAGCCATAAAAGG - Intergenic
1046296235 8:112221850-112221872 ATATACTATGCAGCCAGAAAAGG + Intergenic
1046301536 8:112299014-112299036 GAATCCTATTGAGCAATAAAAGG + Intronic
1046601248 8:116319579-116319601 GAAGACTATGCAGCCATAAAAGG + Intergenic
1046603575 8:116345575-116345597 GAATACTATGCAGCCATAAAAGG - Intergenic
1046698123 8:117365704-117365726 GAATATTATTCAGCCTTGAAAGG + Intergenic
1047061376 8:121230539-121230561 GAATACTACTCAGCCATAAAAGG - Intergenic
1047146453 8:122204837-122204859 GAATTTTATTCAGCCATAAAAGG + Intergenic
1047155885 8:122318068-122318090 GAATATTATGCAGCAATTAAAGG + Intergenic
1047257211 8:123223759-123223781 GAATATTATTTAGCCATAGAAGG + Intronic
1047472907 8:125196537-125196559 GAATACTATGCAGCCATAAAAGG - Intronic
1047593620 8:126353698-126353720 GAATACTACTCAGCCACAAAAGG + Intergenic
1047630709 8:126704650-126704672 GAATATTATTCAGCCATAAAAGG + Intergenic
1048033428 8:130654242-130654264 GAATAGTATGCAGCCATAAAAGG + Intergenic
1048101992 8:131362353-131362375 GAATACTATTCTGCCACAAAGGG + Intergenic
1049044043 8:140135439-140135461 GAATATTATTCAGCCATAAAGGG + Intronic
1049291389 8:141804574-141804596 GAATATGATTCAGCAATAAAAGG - Intergenic
1049916609 9:323843-323865 GAATATTATTTAGCCATAAAAGG - Intronic
1050071579 9:1820473-1820495 GAATACTATGCAGCCAAAAAAGG - Intergenic
1050375856 9:4972128-4972150 GAATATTATTCATCAATAAAAGG - Intergenic
1050390714 9:5141046-5141068 GAGTACTATGCAGCATAAAAAGG - Intronic
1050404189 9:5290595-5290617 GAATACTATTCAGTGCTAAAAGG + Intergenic
1050499263 9:6277915-6277937 AAATACTATTCAGCAATAAAAGG + Intergenic
1050566691 9:6891311-6891333 GAAGATTATTCAGCCATAAAAGG + Intronic
1050754822 9:8989542-8989564 GAATATTATTCAGCCATAGGAGG - Intronic
1050953397 9:11625999-11626021 AAATACTATTTAGCCCTAAAAGG + Intergenic
1051074440 9:13214224-13214246 GAATATTATTCAGCAATAAAGGG + Intronic
1051214811 9:14785590-14785612 TAATACCATTCAGCCTTAAAAGG + Intronic
1051278732 9:15421113-15421135 CAATATTATTCAGCCAAAAAAGG + Intergenic
1051317166 9:15851918-15851940 GCATATTATTCAGCCATAAAAGG - Intronic
1051342558 9:16125341-16125363 GAATATTATGCAGCCAGTGAAGG - Intergenic
1051496992 9:17734604-17734626 AAATATTATTCAGCCATAAAAGG + Intronic
1051628292 9:19119161-19119183 GACTACTGTGTAGCCATTAAAGG - Intronic
1051634257 9:19167260-19167282 GAATACTATGCAGCCATAAAAGG - Intergenic
1052547168 9:29894400-29894422 GAATACTATGCAGCCATAAAAGG + Intergenic
1052550788 9:29945466-29945488 GAATAATATTCAGCAATCAAAGG - Intergenic
1052578868 9:30327708-30327730 AAATATTATTCAGCCATAAAAGG - Intergenic
1052627016 9:30988739-30988761 CAAAACTATGCATCCACAAAAGG - Intergenic
1052777559 9:32748000-32748022 GAATACTACTCAGCTATAAAAGG - Intergenic
1053171281 9:35887003-35887025 AAACATTATTCAGCCATAAAAGG - Intergenic
1053179804 9:35959050-35959072 GAATAAAATGCAAACATAAAAGG - Intergenic
1053233916 9:36434964-36434986 GAATACTCTGCAACTATAAGTGG + Intronic
1053471507 9:38348957-38348979 GCATACTACTCAGCTATAAAAGG - Intergenic
1053679434 9:40472671-40472693 GAATACTATGCAGCCATAAAAGG + Intergenic
1053929428 9:43101016-43101038 GAATACTATGCAGCCATAAAAGG + Intergenic
1054284283 9:63152272-63152294 GAATACTATGCAGCCATAAAAGG - Intergenic
1054292515 9:63308209-63308231 GAATACTATGCAGCCATAAAAGG + Intergenic
1054390535 9:64612683-64612705 GAATACTATGCAGCCATAAAAGG + Intergenic
1054505184 9:65903624-65903646 GAATACTATGCAGCCATAAAAGG - Intergenic
1055005498 9:71501010-71501032 GAAAACTACGCAGCCATAAAAGG + Intergenic
1055296062 9:74834772-74834794 GAATACTATGCAGCCATAAAAGG - Intronic
1055334386 9:75218447-75218469 GAATATTATTCAACCATTAAAGG - Intergenic
1055567906 9:77587454-77587476 GAATATTATTCAGCCATAAAAGG + Intronic
1055656862 9:78459375-78459397 GAATACTACTCAGCCATAAAAGG + Intergenic
1055826144 9:80327301-80327323 GAATATTATTCAGTGATAAAAGG + Intergenic
1055932660 9:81575455-81575477 GAAGACTATGCAGAAATAAAGGG + Intergenic
1055932719 9:81575866-81575888 GAAGACTATGCAGAAATAAAGGG + Intergenic
1056001478 9:82221725-82221747 GAATACTATGCAGTCATAAAAGG + Intergenic
1056040007 9:82655357-82655379 GAATATTATTCATCCATAAAAGG - Intergenic
1056103052 9:83318434-83318456 GAATACTATTGAACCATAAAAGG - Intronic
1056515015 9:87342075-87342097 GAATACTATGCAGCCATAAAAGG + Intergenic
1056828564 9:89894255-89894277 GAATACTAATGAGCAATAAAAGG - Intergenic
1056903840 9:90627330-90627352 AAATATTATTCAGCCTTAAATGG + Intronic
1057062581 9:92018854-92018876 GAATACTCTGCAAGAATAAAAGG + Intergenic
1057148210 9:92772878-92772900 GAACAATATTCAGCCACAAATGG - Intergenic
1057434441 9:95026531-95026553 GAATACTGTCCAGGAATAAAGGG - Intronic
1057545565 9:96017896-96017918 GAATATTATTCAGCCTTGAAAGG + Intergenic
1057642839 9:96843332-96843354 AAATACTACGTAGCTATAAAAGG + Intronic
1057992026 9:99780605-99780627 GAATACTATGCAGCCACAAAAGG - Intergenic
1058187462 9:101871607-101871629 AAATACTACACAGCCATAAAAGG - Intergenic
1058276757 9:103051983-103052005 GAATAGTATTCAGCCACAAAAGG + Intergenic
1058542000 9:106021184-106021206 AAATACTATGCAGGCATAAAAGG + Intergenic
1058678059 9:107417976-107417998 GAATATTATTCAGCATTAAAAGG + Intergenic
1058791733 9:108453421-108453443 GAGTACTATACAGTGATAAAAGG - Intergenic
1058827278 9:108786401-108786423 GAATACTACTCAGCAATAAAAGG + Intergenic
1058873757 9:109224342-109224364 GAACATTATTCAGCCACAAAAGG + Intronic
1058957814 9:109965390-109965412 GAATATTATTCAGCCATAAAAGG + Intronic
1059002305 9:110361567-110361589 GAATACTATTAAGCCATAAAAGG + Intergenic
1059056301 9:110984413-110984435 GAGTATTATTCAGCCAGAAAAGG - Intronic
1059086893 9:111313164-111313186 AAATATTATTCAACCATAAAAGG - Intergenic
1059089653 9:111342204-111342226 GAATACTATGCAGCCATAAATGG + Intergenic
1059327036 9:113510273-113510295 GAATACTACTCAGCCATAAAAGG - Intronic
1059930254 9:119253409-119253431 GAATATCATTCAGCCATAAAAGG + Intronic
1061710556 9:132484575-132484597 GAATATTATTCAGCCGTAACCGG - Intronic
1062317113 9:135973032-135973054 GAATATTACTCAGCCTTAAAAGG - Intergenic
1062758546 9:138322407-138322429 GAATACTACTCAGCCTTAATAGG - Intergenic
1185716862 X:2349727-2349749 GGATACTTTACAGCCTTAAACGG + Intronic
1185925532 X:4141840-4141862 GAATACTATTTAGCCATAAAAGG - Intergenic
1185965655 X:4598970-4598992 GAATATTATTCAGCTATACATGG + Intergenic
1185985462 X:4827713-4827735 GAATAGTATGCAGTCATAAAAGG + Intergenic
1186153880 X:6705958-6705980 GAATATAATACAGCCTTAAAAGG + Intergenic
1186208739 X:7228053-7228075 GAATACTATGCAGCCTTAAAAGG - Intronic
1186301091 X:8200593-8200615 GAATACTCTGCAGCTACAAAAGG - Intergenic
1186310650 X:8314348-8314370 GAGTATTATTCAGCCATAAAAGG - Intergenic
1186446715 X:9635961-9635983 GCATAGTATTCAGCCATAAAAGG + Intronic
1186771382 X:12821259-12821281 GAATACTATTCAGCCTTTAAAGG + Intronic
1186924511 X:14318159-14318181 GAATACTATTCAGCCATAAAAGG + Intergenic
1187147511 X:16651049-16651071 GAAAAATATGCAGCCAAAGAAGG + Exonic
1187196005 X:17084259-17084281 AAAGATTATTCAGCCATAAAAGG - Intronic
1187291151 X:17954499-17954521 GAATACTATTCAGCCATAAAAGG + Intergenic
1187465318 X:19521535-19521557 GAATAGTACTCAGCGATAAATGG - Intergenic
1187567049 X:20461170-20461192 GAATACTACCCAGCAAGAAAAGG - Intergenic
1187586807 X:20671947-20671969 GAATGCTGTGCAGCCATAAAAGG - Intergenic
1187609224 X:20922181-20922203 GAATACTACTCAACCATAAAAGG - Intergenic
1187776824 X:22769564-22769586 GAATAATATTCAGTAATAAAAGG - Intergenic
1187928670 X:24274146-24274168 GAATATTCTTCAGCCTTAAAAGG - Intergenic
1188038906 X:25349463-25349485 GAATATTATTCAGCCTTAAAAGG - Intergenic
1188062746 X:25620743-25620765 GAATACTACTCAGCAATAAAAGG - Intergenic
1188145507 X:26607511-26607533 GAAAACTATGCATCCAACAAAGG + Intergenic
1188176635 X:26998958-26998980 GAATGCTACTTAGCCATAAAAGG + Intergenic
1188229771 X:27647214-27647236 GAGTACTATGCAGCCATAAAAGG + Intronic
1188338150 X:28964371-28964393 GAATACTATGCAGCAAATAAAGG - Intronic
1188379337 X:29471885-29471907 GAATATTATTCATCTATAAAAGG - Intronic
1188433109 X:30129371-30129393 GAATACTATGCAGCCATAAAAGG + Intergenic
1188509370 X:30918579-30918601 GAATACTAGTCAGCTATAAAAGG - Intronic
1188714189 X:33440754-33440776 GAATATTATCCAGCCATAACAGG + Intergenic
1188715227 X:33451816-33451838 GAATATTATGCAGCCATGAAAGG + Intergenic
1188875474 X:35425371-35425393 GAATACTACTTAGCAATAAAAGG + Intergenic
1188963007 X:36516658-36516680 GAGTACTATTCTGCCATAAAAGG + Intergenic
1188989274 X:36798026-36798048 GAATATTATTCAGCCACAAAAGG + Intergenic
1189190309 X:39095940-39095962 GAATATTATTCAGCCTTAAAAGG + Intergenic
1189272729 X:39762539-39762561 GAATATGATTCAGCCATAAGAGG - Intergenic
1189489622 X:41459729-41459751 GAATACTACTCAGCAATAAAAGG - Intronic
1189519959 X:41756451-41756473 GAATACTATATAGCAATGAAAGG + Intronic
1189581175 X:42408041-42408063 GAATACTATGCAGCCATAAAAGG - Intergenic
1189637839 X:43031232-43031254 GAATACTATGCAGCATAAAAAGG + Intergenic
1189770430 X:44420164-44420186 GAAGACTTCTCAGCCATAAAAGG + Intergenic
1189861997 X:45282151-45282173 GAATACTATGCAGCCATAAAAGG - Intergenic
1190020260 X:46867838-46867860 GAATATTAGTCAGCCATAAAAGG - Intronic
1190105538 X:47558314-47558336 GAATACTACTCAGCAATGAAAGG - Intergenic
1190299969 X:49051466-49051488 GACTACTGTTCAGCAATAAAAGG + Intergenic
1190383276 X:49860306-49860328 AAATACTATTCAGCAATAAAAGG - Intergenic
1190383915 X:49865890-49865912 GAATACTATTCACCAATAAAAGG - Intergenic
1190414634 X:50168753-50168775 GAATATTATCCAGCTATCAAAGG + Intergenic
1190428543 X:50355264-50355286 GACTACTACTCAGCCATAAAAGG - Intergenic
1190868918 X:54408678-54408700 GAATATAATTCAGCCATAAGAGG + Intergenic
1190894278 X:54601001-54601023 GAATATTATTCAGCAATAATAGG + Intergenic
1190925920 X:54904551-54904573 GAATACTATGCCGCCATAAAAGG + Intergenic
1191037160 X:56038553-56038575 GAATGCTATGCAGCCATAAAAGG - Intergenic
1191043450 X:56110120-56110142 GAATACTATGCAGCCATAAAAGG - Intergenic
1191078321 X:56481228-56481250 GAATACTACGCAGCCAAAGAAGG - Intergenic
1191817268 X:65259876-65259898 GAGCACTACTCAGCCATAAAAGG + Intergenic
1191854398 X:65611549-65611571 GAATATTATTCAGCCTTACAAGG - Intronic
1191931445 X:66377532-66377554 GAATACTATACAGCTATAAAAGG - Intergenic
1191963887 X:66734710-66734732 GAGTACTATTCAGCAATAAGAGG - Intergenic
1191965645 X:66754203-66754225 GAATACTACTCAACCATACAAGG - Intergenic
1191995765 X:67093780-67093802 AAATACTACTCAGCCATAAAAGG - Intergenic
1192002831 X:67174300-67174322 GAATACTACTCAACCATAAAAGG + Intergenic
1192137373 X:68616411-68616433 GACTACTATTCAGCACTAAAAGG - Intergenic
1192267734 X:69551223-69551245 GAATACTACTCAGCAATAAAAGG + Intergenic
1192285842 X:69735320-69735342 GAATATTATTTAGCCTTAAAAGG + Intronic
1192381093 X:70617483-70617505 AGATACTACTCAGCCATAAAAGG + Intronic
1192586330 X:72321107-72321129 GGATATTATTCAGCCTTAAAAGG - Intergenic
1192655639 X:72990766-72990788 GAATACTATGTGGCCATAAAAGG + Intergenic
1192677834 X:73217995-73218017 GAATATTATTCAGCTATAAAAGG + Intergenic
1192683645 X:73281201-73281223 GTAAACTATGCATCCAAAAAAGG + Intergenic
1192711480 X:73594936-73594958 GAATGCTATTAAGCCATAAAAGG - Intronic
1192978327 X:76310645-76310667 GAATACTACTCAGCCATAAATGG - Intergenic
1193054023 X:77130727-77130749 GAATACTACTTAGCCATAAAAGG + Intergenic
1193063055 X:77226936-77226958 GAATAACACTCAGCCATAAAAGG + Intergenic
1193135406 X:77965793-77965815 GAATATTATTCAGCCATAAAAGG + Intronic
1193178617 X:78426141-78426163 GAATATTATTCAGGTATAAAAGG + Intergenic
1193215933 X:78864570-78864592 GAATACCATGGAGTCTTAAAAGG + Intergenic
1193231054 X:79047111-79047133 GAATACTACTCAGCCATAAAAGG + Intergenic
1193259217 X:79385873-79385895 GAATACTATGCGGCCATAAAAGG + Intergenic
1193303612 X:79923144-79923166 GAATACTATGCAGCCATAAAAGG + Intergenic
1193323336 X:80150367-80150389 GAATACTATTCAGCCATAAAAGG + Intergenic
1193328542 X:80209841-80209863 AAATACTATGCAGCAAAACAAGG + Intergenic
1193367273 X:80650320-80650342 GAATATTATTCAGCCTTAAAAGG - Intergenic
1193470897 X:81901991-81902013 TAATACTATTTAGCCTTAAAAGG - Intergenic
1193503764 X:82313650-82313672 AAATATTATTCAGCTATAAAAGG - Intergenic
1193644841 X:84054963-84054985 GAATACTATGCAGCCATGAGAGG - Intergenic
1193670817 X:84383887-84383909 GAATACTATGGAGGCATAAAAGG - Intronic
1193702947 X:84785836-84785858 GAATACTACTCAGCCATAAAAGG - Intergenic
1193720881 X:84986123-84986145 GAATACTATTCAGAGATAAAAGG - Intergenic
1193782630 X:85722410-85722432 AAATACTATTCAGCCAGAAAAGG - Intergenic
1193853547 X:86570392-86570414 GAATACTATGCAGCCATAAAGGG + Intronic
1193877242 X:86875165-86875187 GAATACTACACAGCCATAAAAGG - Intergenic
1194081106 X:89466289-89466311 GAATACTACTCAGCCATCAAAGG + Intergenic
1194104151 X:89747525-89747547 AATTACTACTCAGCCATAAAAGG - Intergenic
1194109924 X:89820973-89820995 GAATACTACACAGCCATGAAAGG - Intergenic
1194126012 X:90017650-90017672 GAATACTACTAAGCCATAAAAGG + Intergenic
1194206983 X:91021262-91021284 GAATATTATTTAACCATAAAAGG - Intergenic
1194231109 X:91324634-91324656 GAATACTATGCAGCCATAAAAGG + Intergenic
1194406279 X:93499942-93499964 GAATACTATGCAGCCATAAAAGG + Intergenic
1194418618 X:93644765-93644787 AAATACTATGAAGCCATAAAAGG - Intergenic
1194475411 X:94353288-94353310 GAATACTACTCAGCAATAGAAGG + Intergenic
1194817204 X:98457601-98457623 GAATACTCTTCAGCCTTAAAAGG - Intergenic
1194827405 X:98579570-98579592 GAATACTATTCAGCCATAAAAGG - Intergenic
1194902453 X:99530012-99530034 GAATACTACACAGCCATTAAAGG + Intergenic
1194929965 X:99875650-99875672 GAATGCTAAGTAACCATAAAAGG - Intergenic
1194949629 X:100109733-100109755 GAATACTATGCAGCCATAAAAGG - Intergenic
1194955136 X:100169930-100169952 GATTACTATTCAGCAATAAAAGG + Intergenic
1195375570 X:104224259-104224281 GAATATTATTTAGCCACAAAAGG + Intergenic
1195424256 X:104710289-104710311 GAATATTATTTAGCCGTAAAAGG + Intronic
1195550926 X:106169736-106169758 GAATACTACGCAGCTGTAAAAGG + Intronic
1195578819 X:106479102-106479124 GAATGCTTCGCAGCCATAAAAGG + Intergenic
1195665971 X:107431085-107431107 GAGTACTACTCAGCAATAAAAGG + Intergenic
1195781948 X:108476767-108476789 GAGTACTATTCAGCCATAAAAGG - Intronic
1195809360 X:108812988-108813010 GAGTGCTATGCAGCCATAGGAGG - Intergenic
1195823439 X:108971297-108971319 GAACACTACTCAGTCATAAAAGG + Intergenic
1195839036 X:109151679-109151701 GAATACTACTCAGCCACAAAAGG + Intergenic
1195915631 X:109932417-109932439 GAATACTATGCAGCCATAAAAGG - Intergenic
1196126001 X:112099505-112099527 CAAAACTATGAAGCCATAAAAGG + Intergenic
1196168445 X:112561253-112561275 AAACACTATGCAGCCATGAAAGG + Intergenic
1196238233 X:113307945-113307967 AAATACTATTCAGCTATAAAAGG + Intergenic
1196310644 X:114161603-114161625 GCAAACTATTCATCCATAAAAGG - Intergenic
1196475824 X:116084344-116084366 GCAAACTATGCATCTATAAAAGG + Intergenic
1196713667 X:118790322-118790344 GAATACTGCTCAGCAATAAAAGG - Intronic
1196902130 X:120395350-120395372 GTGTATTATTCAGCCATAAAAGG + Intergenic
1196998072 X:121406184-121406206 TAATACTATGCAGCTGTGAAAGG - Intergenic
1197007786 X:121523646-121523668 AAATACTATGCAGCCATAAAAGG + Intergenic
1197164757 X:123364767-123364789 GAATACTATTTAGCCATAAAAGG + Intronic
1197231108 X:124004538-124004560 GAAAATTATTCAGCCTTAAAAGG - Intronic
1197368988 X:125602320-125602342 GAATACTATGCAGCCATAAGAGG + Intergenic
1197444391 X:126531821-126531843 AAATATTATTCAGCCAAAAAAGG + Intergenic
1197483223 X:127013139-127013161 GAATATTATTCAGCCATAAAAGG - Intergenic
1197485452 X:127044660-127044682 CAATATTATTCAGCCATAAAAGG - Intergenic
1197549016 X:127864868-127864890 GAATACTACTCAGCTATAAAAGG + Intergenic
1197555967 X:127954162-127954184 GAATATTATTCAGAAATAAAAGG + Intergenic
1198262726 X:134980102-134980124 GAATACTACTCAGACATAAAAGG - Intergenic
1198315092 X:135457166-135457188 GAATATTATTCTGCCATAAAAGG - Intergenic
1198318232 X:135491185-135491207 GAATATGATGCAATCATAAAAGG + Intergenic
1198511619 X:137357557-137357579 AAATATTATTCAGTCATAAAAGG + Intergenic
1198578026 X:138032309-138032331 GAATACTATGCAGGCAAAAAAGG + Intergenic
1198646536 X:138813034-138813056 AAATACTATGCAGCCATAAAAGG - Intronic
1198757725 X:139998378-139998400 GAATACTACGCAGCTATGAAAGG - Intergenic
1198843053 X:140879937-140879959 GAATAATATGTAGCCATTGAAGG - Intergenic
1198885343 X:141329492-141329514 GAATACTATGCAGCCATAAAAGG + Intergenic
1198889939 X:141382817-141382839 AAATACTACTCAGCCATAAAAGG + Intergenic
1198979957 X:142383675-142383697 GAAGACTATACAGGAATAAAAGG - Intergenic
1199068230 X:143445268-143445290 GAATACTATGCAGCCAAAAAAGG - Intergenic
1199105177 X:143857980-143858002 GAATACTATGCAACCATAAAAGG + Intergenic
1199200554 X:145083363-145083385 GAATATTATTCAGCCATAAAAGG - Intergenic
1199224337 X:145354823-145354845 GAATACTGTGCAGCCATAAAAGG + Intergenic
1199566413 X:149220393-149220415 GAATTACATGCAGCCATGAAGGG + Intergenic
1199669913 X:150136331-150136353 AAATACTACTCAGCAATAAAAGG + Intergenic
1199707211 X:150438696-150438718 GAATATTATTCAGCCATAAAGGG - Intronic
1199767452 X:150951629-150951651 GAACATTATTCAGCCATAAGAGG - Intergenic
1199784699 X:151094264-151094286 GAATATTATTCAGCCATAAAAGG - Intergenic
1199837737 X:151609646-151609668 AAATATTATTCAGCCTTAAAAGG - Intronic
1199914111 X:152320378-152320400 GAATACTACTCAGCCATAAAAGG + Intronic
1199964024 X:152803477-152803499 GAATATTATGCAACCATAAAAGG - Intergenic
1200405104 Y:2802092-2802114 GAATACTATGCAGCCACAAAAGG - Intergenic
1200433779 Y:3122489-3122511 GAATACTACTCAGCCATCAAAGG + Intergenic
1200456103 Y:3395334-3395356 AATTACTACTCAGCCATAAAAGG - Intergenic
1200459112 Y:3432465-3432487 GAGTACTCTTCAGCCATAAAAGG + Intergenic
1200552735 Y:4596051-4596073 GAATATTATTTAACCATAAAAGG - Intergenic
1200740838 Y:6852310-6852332 GGATACTATGCAGCCATAAAAGG - Intergenic
1200818951 Y:7562557-7562579 GAATACTACTCAGCCTAAAAAGG + Intergenic
1201350957 Y:13040772-13040794 GAATATTATTCGGCCTTAAAGGG + Intergenic
1201364629 Y:13190008-13190030 GAATACTATGCAGTCATAAAAGG - Intergenic
1201579722 Y:15498379-15498401 GAATATTATGCAGCCTTAAAAGG - Intergenic
1201714238 Y:17026713-17026735 GAATACTATGTAGCATAAAAAGG + Intergenic
1201933579 Y:19381146-19381168 GAATACTATGCAGCCATAATAGG - Intergenic