ID: 1043226983

View in Genome Browser
Species Human (GRCh38)
Location 8:77745678-77745700
Sequence CAGCCTGAGGTTTGGGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043226983_1043226993 -2 Left 1043226983 8:77745678-77745700 CCCCCTCCCCAAACCTCAGGCTG No data
Right 1043226993 8:77745699-77745721 TGTTCAGCCCACAGCTCCAGGGG No data
1043226983_1043226992 -3 Left 1043226983 8:77745678-77745700 CCCCCTCCCCAAACCTCAGGCTG No data
Right 1043226992 8:77745698-77745720 CTGTTCAGCCCACAGCTCCAGGG No data
1043226983_1043226997 26 Left 1043226983 8:77745678-77745700 CCCCCTCCCCAAACCTCAGGCTG No data
Right 1043226997 8:77745727-77745749 ACTTTTCTTTGCTTGAGAAAAGG No data
1043226983_1043226991 -4 Left 1043226983 8:77745678-77745700 CCCCCTCCCCAAACCTCAGGCTG No data
Right 1043226991 8:77745697-77745719 GCTGTTCAGCCCACAGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043226983 Original CRISPR CAGCCTGAGGTTTGGGGAGG GGG (reversed) Intergenic
No off target data available for this crispr