ID: 1043231156

View in Genome Browser
Species Human (GRCh38)
Location 8:77803072-77803094
Sequence AATGAGATTACAGAGTACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043231156_1043231160 20 Left 1043231156 8:77803072-77803094 CCAGTGTACTCTGTAATCTCATT No data
Right 1043231160 8:77803115-77803137 AAACCCTGCTTTGGAAAGATAGG No data
1043231156_1043231163 27 Left 1043231156 8:77803072-77803094 CCAGTGTACTCTGTAATCTCATT No data
Right 1043231163 8:77803122-77803144 GCTTTGGAAAGATAGGATGTTGG No data
1043231156_1043231159 11 Left 1043231156 8:77803072-77803094 CCAGTGTACTCTGTAATCTCATT No data
Right 1043231159 8:77803106-77803128 CACTGCAGAAAACCCTGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043231156 Original CRISPR AATGAGATTACAGAGTACAC TGG (reversed) Intergenic