ID: 1043231160

View in Genome Browser
Species Human (GRCh38)
Location 8:77803115-77803137
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043231156_1043231160 20 Left 1043231156 8:77803072-77803094 CCAGTGTACTCTGTAATCTCATT No data
Right 1043231160 8:77803115-77803137 AAACCCTGCTTTGGAAAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043231160 Original CRISPR AAACCCTGCTTTGGAAAGAT AGG Intergenic