ID: 1043231163

View in Genome Browser
Species Human (GRCh38)
Location 8:77803122-77803144
Sequence GCTTTGGAAAGATAGGATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043231156_1043231163 27 Left 1043231156 8:77803072-77803094 CCAGTGTACTCTGTAATCTCATT No data
Right 1043231163 8:77803122-77803144 GCTTTGGAAAGATAGGATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043231163 Original CRISPR GCTTTGGAAAGATAGGATGT TGG Intergenic