ID: 1043231178

View in Genome Browser
Species Human (GRCh38)
Location 8:77803317-77803339
Sequence GCTTATTCACAGATGGAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043231174_1043231178 10 Left 1043231174 8:77803284-77803306 CCTTTTCTAGGACAGACAAAATC No data
Right 1043231178 8:77803317-77803339 GCTTATTCACAGATGGAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043231178 Original CRISPR GCTTATTCACAGATGGAGCA CGG Intergenic
No off target data available for this crispr