ID: 1043232520

View in Genome Browser
Species Human (GRCh38)
Location 8:77820933-77820955
Sequence ACTCATCTGCAGGTGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043232517_1043232520 4 Left 1043232517 8:77820906-77820928 CCAACAGCTGTTTTTTAAAAGGA No data
Right 1043232520 8:77820933-77820955 ACTCATCTGCAGGTGATGGCAGG No data
1043232515_1043232520 16 Left 1043232515 8:77820894-77820916 CCGAGTAGCAGGCCAACAGCTGT No data
Right 1043232520 8:77820933-77820955 ACTCATCTGCAGGTGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043232520 Original CRISPR ACTCATCTGCAGGTGATGGC AGG Intergenic
No off target data available for this crispr