ID: 1043238504

View in Genome Browser
Species Human (GRCh38)
Location 8:77899968-77899990
Sequence GCTTAGGGGTGCAGCAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043238492_1043238504 23 Left 1043238492 8:77899922-77899944 CCGCCTGTGGCTGCCTGCTAGGG No data
Right 1043238504 8:77899968-77899990 GCTTAGGGGTGCAGCAGGCCAGG No data
1043238497_1043238504 10 Left 1043238497 8:77899935-77899957 CCTGCTAGGGTCTCCAGGGTTTT No data
Right 1043238504 8:77899968-77899990 GCTTAGGGGTGCAGCAGGCCAGG No data
1043238494_1043238504 20 Left 1043238494 8:77899925-77899947 CCTGTGGCTGCCTGCTAGGGTCT No data
Right 1043238504 8:77899968-77899990 GCTTAGGGGTGCAGCAGGCCAGG No data
1043238499_1043238504 -3 Left 1043238499 8:77899948-77899970 CCAGGGTTTTTATAGGCACAGCT No data
Right 1043238504 8:77899968-77899990 GCTTAGGGGTGCAGCAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043238504 Original CRISPR GCTTAGGGGTGCAGCAGGCC AGG Intergenic
No off target data available for this crispr