ID: 1043247845

View in Genome Browser
Species Human (GRCh38)
Location 8:78028438-78028460
Sequence TAGAAGTCTAACTTCTATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043247845_1043247850 1 Left 1043247845 8:78028438-78028460 CCATTATAGAAGTTAGACTTCTA No data
Right 1043247850 8:78028462-78028484 CCTCCTGCAGACTGGGAGATAGG No data
1043247845_1043247851 2 Left 1043247845 8:78028438-78028460 CCATTATAGAAGTTAGACTTCTA No data
Right 1043247851 8:78028463-78028485 CTCCTGCAGACTGGGAGATAGGG No data
1043247845_1043247846 -7 Left 1043247845 8:78028438-78028460 CCATTATAGAAGTTAGACTTCTA No data
Right 1043247846 8:78028454-78028476 ACTTCTACCCTCCTGCAGACTGG No data
1043247845_1043247847 -6 Left 1043247845 8:78028438-78028460 CCATTATAGAAGTTAGACTTCTA No data
Right 1043247847 8:78028455-78028477 CTTCTACCCTCCTGCAGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043247845 Original CRISPR TAGAAGTCTAACTTCTATAA TGG (reversed) Intergenic
No off target data available for this crispr