ID: 1043247847

View in Genome Browser
Species Human (GRCh38)
Location 8:78028455-78028477
Sequence CTTCTACCCTCCTGCAGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043247845_1043247847 -6 Left 1043247845 8:78028438-78028460 CCATTATAGAAGTTAGACTTCTA No data
Right 1043247847 8:78028455-78028477 CTTCTACCCTCCTGCAGACTGGG No data
1043247844_1043247847 15 Left 1043247844 8:78028417-78028439 CCATCTGCGTTTGCTAATTGTCC No data
Right 1043247847 8:78028455-78028477 CTTCTACCCTCCTGCAGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043247847 Original CRISPR CTTCTACCCTCCTGCAGACT GGG Intergenic
No off target data available for this crispr