ID: 1043247851

View in Genome Browser
Species Human (GRCh38)
Location 8:78028463-78028485
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043247845_1043247851 2 Left 1043247845 8:78028438-78028460 CCATTATAGAAGTTAGACTTCTA No data
Right 1043247851 8:78028463-78028485 CTCCTGCAGACTGGGAGATAGGG No data
1043247844_1043247851 23 Left 1043247844 8:78028417-78028439 CCATCTGCGTTTGCTAATTGTCC No data
Right 1043247851 8:78028463-78028485 CTCCTGCAGACTGGGAGATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043247851 Original CRISPR CTCCTGCAGACTGGGAGATA GGG Intergenic