ID: 1043252190

View in Genome Browser
Species Human (GRCh38)
Location 8:78088721-78088743
Sequence CCATTTTCATGGCTAGATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043252190_1043252194 13 Left 1043252190 8:78088721-78088743 CCAGGATCTAGCCATGAAAATGG No data
Right 1043252194 8:78088757-78088779 GCATGTAGTCTGTGTATCTATGG No data
1043252190_1043252197 30 Left 1043252190 8:78088721-78088743 CCAGGATCTAGCCATGAAAATGG No data
Right 1043252197 8:78088774-78088796 CTATGGATGTGCGGGCAAGAAGG No data
1043252190_1043252196 22 Left 1043252190 8:78088721-78088743 CCAGGATCTAGCCATGAAAATGG No data
Right 1043252196 8:78088766-78088788 CTGTGTATCTATGGATGTGCGGG No data
1043252190_1043252195 21 Left 1043252190 8:78088721-78088743 CCAGGATCTAGCCATGAAAATGG No data
Right 1043252195 8:78088765-78088787 TCTGTGTATCTATGGATGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043252190 Original CRISPR CCATTTTCATGGCTAGATCC TGG (reversed) Intergenic
No off target data available for this crispr