ID: 1043252197

View in Genome Browser
Species Human (GRCh38)
Location 8:78088774-78088796
Sequence CTATGGATGTGCGGGCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043252190_1043252197 30 Left 1043252190 8:78088721-78088743 CCAGGATCTAGCCATGAAAATGG No data
Right 1043252197 8:78088774-78088796 CTATGGATGTGCGGGCAAGAAGG No data
1043252193_1043252197 19 Left 1043252193 8:78088732-78088754 CCATGAAAATGGATGGTTAAAGT No data
Right 1043252197 8:78088774-78088796 CTATGGATGTGCGGGCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043252197 Original CRISPR CTATGGATGTGCGGGCAAGA AGG Intergenic
No off target data available for this crispr