ID: 1043252926

View in Genome Browser
Species Human (GRCh38)
Location 8:78098456-78098478
Sequence TTGGACCCTCACTGACATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043252921_1043252926 8 Left 1043252921 8:78098425-78098447 CCCTTGTTCCAGGAATGGGTAAG No data
Right 1043252926 8:78098456-78098478 TTGGACCCTCACTGACATCTAGG No data
1043252918_1043252926 17 Left 1043252918 8:78098416-78098438 CCTGGAGTGCCCTTGTTCCAGGA No data
Right 1043252926 8:78098456-78098478 TTGGACCCTCACTGACATCTAGG No data
1043252922_1043252926 7 Left 1043252922 8:78098426-78098448 CCTTGTTCCAGGAATGGGTAAGT No data
Right 1043252926 8:78098456-78098478 TTGGACCCTCACTGACATCTAGG No data
1043252924_1043252926 0 Left 1043252924 8:78098433-78098455 CCAGGAATGGGTAAGTGGTTTCT No data
Right 1043252926 8:78098456-78098478 TTGGACCCTCACTGACATCTAGG No data
1043252916_1043252926 25 Left 1043252916 8:78098408-78098430 CCACTTTTCCTGGAGTGCCCTTG No data
Right 1043252926 8:78098456-78098478 TTGGACCCTCACTGACATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043252926 Original CRISPR TTGGACCCTCACTGACATCT AGG Intergenic
No off target data available for this crispr