ID: 1043259283

View in Genome Browser
Species Human (GRCh38)
Location 8:78177214-78177236
Sequence AACTAATTATTTAGGAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043259283_1043259286 -10 Left 1043259283 8:78177214-78177236 CCCTCTTTCCTAAATAATTAGTT No data
Right 1043259286 8:78177227-78177249 ATAATTAGTTATTCTACTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043259283 Original CRISPR AACTAATTATTTAGGAAAGA GGG (reversed) Intergenic
No off target data available for this crispr