ID: 1043259713

View in Genome Browser
Species Human (GRCh38)
Location 8:78181095-78181117
Sequence GACATTTAACAATATGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043259713_1043259716 0 Left 1043259713 8:78181095-78181117 CCCAGTTCATATTGTTAAATGTC No data
Right 1043259716 8:78181118-78181140 AAGTGACGTGTTGCTGAAGAGGG No data
1043259713_1043259715 -1 Left 1043259713 8:78181095-78181117 CCCAGTTCATATTGTTAAATGTC No data
Right 1043259715 8:78181117-78181139 CAAGTGACGTGTTGCTGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043259713 Original CRISPR GACATTTAACAATATGAACT GGG (reversed) Intergenic
No off target data available for this crispr