ID: 1043259973

View in Genome Browser
Species Human (GRCh38)
Location 8:78184223-78184245
Sequence AGCTATCTGCAGAAGATGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043259972_1043259973 9 Left 1043259972 8:78184191-78184213 CCAGGTCAAGAGCGCTCTCTCAA No data
Right 1043259973 8:78184223-78184245 AGCTATCTGCAGAAGATGACAGG No data
1043259971_1043259973 15 Left 1043259971 8:78184185-78184207 CCAGTACCAGGTCAAGAGCGCTC No data
Right 1043259973 8:78184223-78184245 AGCTATCTGCAGAAGATGACAGG No data
1043259969_1043259973 22 Left 1043259969 8:78184178-78184200 CCAAAGCCCAGTACCAGGTCAAG No data
Right 1043259973 8:78184223-78184245 AGCTATCTGCAGAAGATGACAGG No data
1043259968_1043259973 25 Left 1043259968 8:78184175-78184197 CCACCAAAGCCCAGTACCAGGTC No data
Right 1043259973 8:78184223-78184245 AGCTATCTGCAGAAGATGACAGG No data
1043259970_1043259973 16 Left 1043259970 8:78184184-78184206 CCCAGTACCAGGTCAAGAGCGCT No data
Right 1043259973 8:78184223-78184245 AGCTATCTGCAGAAGATGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043259973 Original CRISPR AGCTATCTGCAGAAGATGAC AGG Intergenic
No off target data available for this crispr