ID: 1043261709

View in Genome Browser
Species Human (GRCh38)
Location 8:78208373-78208395
Sequence GAGTAAAAACAGAAGCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043261701_1043261709 28 Left 1043261701 8:78208322-78208344 CCTTAAGGCTGTTACAGAAATGG No data
Right 1043261709 8:78208373-78208395 GAGTAAAAACAGAAGCAGCATGG No data
1043261700_1043261709 29 Left 1043261700 8:78208321-78208343 CCCTTAAGGCTGTTACAGAAATG No data
Right 1043261709 8:78208373-78208395 GAGTAAAAACAGAAGCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043261709 Original CRISPR GAGTAAAAACAGAAGCAGCA TGG Intergenic
No off target data available for this crispr