ID: 1043265670

View in Genome Browser
Species Human (GRCh38)
Location 8:78265285-78265307
Sequence ATTCTGTTGTGCCCAAACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043265670_1043265671 -5 Left 1043265670 8:78265285-78265307 CCAGGGTTTGGGCACAACAGAAT No data
Right 1043265671 8:78265303-78265325 AGAATTTCAAAATTTAAAAAAGG No data
1043265670_1043265672 16 Left 1043265670 8:78265285-78265307 CCAGGGTTTGGGCACAACAGAAT No data
Right 1043265672 8:78265324-78265346 GGTTTACGAATAGAATTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043265670 Original CRISPR ATTCTGTTGTGCCCAAACCC TGG (reversed) Intergenic
No off target data available for this crispr