ID: 1043269823

View in Genome Browser
Species Human (GRCh38)
Location 8:78318325-78318347
Sequence AATTATCTTCAGTTTGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043269823_1043269827 24 Left 1043269823 8:78318325-78318347 CCCAGCCCAAACTGAAGATAATT No data
Right 1043269827 8:78318372-78318394 TAAGCCACTAAGATTTAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043269823 Original CRISPR AATTATCTTCAGTTTGGGCT GGG (reversed) Intergenic