ID: 1043270165

View in Genome Browser
Species Human (GRCh38)
Location 8:78323119-78323141
Sequence AGCCAGTTACAGAACTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043270165_1043270168 -3 Left 1043270165 8:78323119-78323141 CCTCCAAAGTTCTGTAACTGGCT No data
Right 1043270168 8:78323139-78323161 GCTCACTATCTGGTAACAGATGG No data
1043270165_1043270169 -2 Left 1043270165 8:78323119-78323141 CCTCCAAAGTTCTGTAACTGGCT No data
Right 1043270169 8:78323140-78323162 CTCACTATCTGGTAACAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043270165 Original CRISPR AGCCAGTTACAGAACTTTGG AGG (reversed) Intergenic
No off target data available for this crispr