ID: 1043270711

View in Genome Browser
Species Human (GRCh38)
Location 8:78329733-78329755
Sequence GGGTCCCAGGGACCACAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043270711_1043270724 12 Left 1043270711 8:78329733-78329755 CCTCCTTGTGGTCCCTGGGACCC No data
Right 1043270724 8:78329768-78329790 TGGATCACCCTGTCAGGGACTGG No data
1043270711_1043270726 14 Left 1043270711 8:78329733-78329755 CCTCCTTGTGGTCCCTGGGACCC No data
Right 1043270726 8:78329770-78329792 GATCACCCTGTCAGGGACTGGGG No data
1043270711_1043270721 6 Left 1043270711 8:78329733-78329755 CCTCCTTGTGGTCCCTGGGACCC No data
Right 1043270721 8:78329762-78329784 CCAGCCTGGATCACCCTGTCAGG No data
1043270711_1043270725 13 Left 1043270711 8:78329733-78329755 CCTCCTTGTGGTCCCTGGGACCC No data
Right 1043270725 8:78329769-78329791 GGATCACCCTGTCAGGGACTGGG No data
1043270711_1043270716 -8 Left 1043270711 8:78329733-78329755 CCTCCTTGTGGTCCCTGGGACCC No data
Right 1043270716 8:78329748-78329770 TGGGACCCTGGAGCCCAGCCTGG No data
1043270711_1043270722 7 Left 1043270711 8:78329733-78329755 CCTCCTTGTGGTCCCTGGGACCC No data
Right 1043270722 8:78329763-78329785 CAGCCTGGATCACCCTGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043270711 Original CRISPR GGGTCCCAGGGACCACAAGG AGG (reversed) Intergenic
No off target data available for this crispr