ID: 1043271953

View in Genome Browser
Species Human (GRCh38)
Location 8:78345100-78345122
Sequence CTGTATATGAATTAGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043271943_1043271953 28 Left 1043271943 8:78345049-78345071 CCGGAAAGATCCCTCACACCTTC No data
Right 1043271953 8:78345100-78345122 CTGTATATGAATTAGGAAGCAGG No data
1043271949_1043271953 3 Left 1043271949 8:78345074-78345096 CCCTGTGAGGTAATGGCAAAATT No data
Right 1043271953 8:78345100-78345122 CTGTATATGAATTAGGAAGCAGG No data
1043271942_1043271953 29 Left 1043271942 8:78345048-78345070 CCCGGAAAGATCCCTCACACCTT No data
Right 1043271953 8:78345100-78345122 CTGTATATGAATTAGGAAGCAGG No data
1043271941_1043271953 30 Left 1043271941 8:78345047-78345069 CCCCGGAAAGATCCCTCACACCT No data
Right 1043271953 8:78345100-78345122 CTGTATATGAATTAGGAAGCAGG No data
1043271944_1043271953 18 Left 1043271944 8:78345059-78345081 CCCTCACACCTTCTACCCTGTGA No data
Right 1043271953 8:78345100-78345122 CTGTATATGAATTAGGAAGCAGG No data
1043271950_1043271953 2 Left 1043271950 8:78345075-78345097 CCTGTGAGGTAATGGCAAAATTT No data
Right 1043271953 8:78345100-78345122 CTGTATATGAATTAGGAAGCAGG No data
1043271947_1043271953 10 Left 1043271947 8:78345067-78345089 CCTTCTACCCTGTGAGGTAATGG No data
Right 1043271953 8:78345100-78345122 CTGTATATGAATTAGGAAGCAGG No data
1043271945_1043271953 17 Left 1043271945 8:78345060-78345082 CCTCACACCTTCTACCCTGTGAG No data
Right 1043271953 8:78345100-78345122 CTGTATATGAATTAGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043271953 Original CRISPR CTGTATATGAATTAGGAAGC AGG Intergenic
No off target data available for this crispr