ID: 1043284868

View in Genome Browser
Species Human (GRCh38)
Location 8:78516252-78516274
Sequence GAGCGGCCCCGCTCCCCCCG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 184}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043284861_1043284868 1 Left 1043284861 8:78516228-78516250 CCAGGCTGCCTTCCCTGGGGTCG 0: 1
1: 0
2: 1
3: 33
4: 299
Right 1043284868 8:78516252-78516274 GAGCGGCCCCGCTCCCCCCGTGG 0: 1
1: 0
2: 0
3: 16
4: 184
1043284865_1043284868 -7 Left 1043284865 8:78516236-78516258 CCTTCCCTGGGGTCGGGAGCGGC 0: 1
1: 0
2: 1
3: 23
4: 191
Right 1043284868 8:78516252-78516274 GAGCGGCCCCGCTCCCCCCGTGG 0: 1
1: 0
2: 0
3: 16
4: 184
1043284857_1043284868 7 Left 1043284857 8:78516222-78516244 CCGTTTCCAGGCTGCCTTCCCTG 0: 1
1: 2
2: 13
3: 145
4: 991
Right 1043284868 8:78516252-78516274 GAGCGGCCCCGCTCCCCCCGTGG 0: 1
1: 0
2: 0
3: 16
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043284868 Original CRISPR GAGCGGCCCCGCTCCCCCCG TGG Exonic
900108413 1:995938-995960 GTGTTGCCCCGTTCCCCCCGCGG + Intergenic
900135185 1:1114153-1114175 GATCCGCCCCCCTCCCCCCACGG + Intronic
900171340 1:1270619-1270641 GAGCCTCCCAACTCCCCCCGTGG + Intronic
900341693 1:2192528-2192550 GTGCTGCCCCCCGCCCCCCGGGG - Intronic
900623687 1:3598713-3598735 GAGCCCCCCCCCCCCCCCCGGGG + Intronic
901381615 1:8878406-8878428 TGGCGCCCCCGCTCACCCCGAGG - Intronic
903435106 1:23343826-23343848 GAGCCGCTTCGCTCCCGCCGCGG - Intronic
903781098 1:25820460-25820482 GCGCGGACCCTCTCCCCGCGGGG - Intronic
905703969 1:40040560-40040582 GAGCGGCCCGGCTCTCACAGAGG - Exonic
905734357 1:40315636-40315658 GGGGGGCCCCGCTCTCCCGGTGG + Exonic
908544076 1:65147752-65147774 GAGGGGCCCACCTCCGCCCGGGG - Intronic
916535372 1:165698596-165698618 CCGCGGCCCCGCCCCTCCCGCGG - Exonic
916535381 1:165698613-165698635 CCGCGGCCCCGCCCCTCCCGCGG - Exonic
919878904 1:201889365-201889387 GCTCGGCCCCACTCCCCCGGCGG - Intronic
922783913 1:228273701-228273723 GACCGGCCCCGCTCCCTTCAGGG - Intronic
1065844815 10:29735862-29735884 GCGGGGACCCGCTCCCCGCGCGG - Intronic
1066370637 10:34815525-34815547 GAGGGGTCCCGCGCCCCCGGAGG - Intergenic
1067937595 10:50624580-50624602 GAGCCGCCCCGCCCCGCCTGGGG + Intronic
1069598306 10:69686930-69686952 GAGCCTCCCTGCTCCCCCCAGGG - Intronic
1073063558 10:100745809-100745831 GAGAGGCCCGGCTCCCCTCCCGG + Exonic
1074618453 10:115093377-115093399 GCGCGGCCCCGCCTCGCCCGCGG - Intronic
1075734501 10:124655549-124655571 GAGTGGCCACGCTCACCCCAAGG - Intronic
1075878083 10:125824046-125824068 GAGGGGGCCCTCTCCCCTCGGGG + Intronic
1076861986 10:133142053-133142075 GAGCGGCCACCATCGCCCCGAGG + Intergenic
1077066083 11:641427-641449 GAGCCGCCCCTCTTCCCCCAGGG - Intergenic
1078417861 11:11180481-11180503 GAGAGGCCCCACAGCCCCCGCGG + Intergenic
1082789202 11:57335675-57335697 CAGGGGCCCCGCTCCCCCACGGG - Intronic
1083681551 11:64354047-64354069 GGGGGGCCCCCCTCCCGCCGGGG - Exonic
1084086151 11:66856354-66856376 CAGCTGCCCCGCCCGCCCCGCGG - Intronic
1084153351 11:67301451-67301473 GAGGGGCCACGCTCAACCCGCGG - Intronic
1084262224 11:67986464-67986486 GAACAGCCCCTCTCCCCCCCTGG - Intergenic
1084431885 11:69115819-69115841 GAGCGGCCCCGCCCTCCCCCAGG - Intergenic
1089502423 11:118940381-118940403 GAGCTTCCCCCCACCCCCCGGGG - Intronic
1089775560 11:120833000-120833022 GAGGAGCCTCGCTCCCCCAGTGG - Intronic
1090890232 11:130916517-130916539 GAGCGTCCGCGCGCGCCCCGAGG + Intergenic
1095853146 12:46831830-46831852 GAGAGGCCCGACTTCCCCCGCGG - Intronic
1096098769 12:48956605-48956627 GACCGCCCCCGCTCCGCCTGGGG + Intronic
1096627255 12:52903571-52903593 GAGGGGCCCCGGGCCCCCGGCGG - Intronic
1097383175 12:58919964-58919986 GCCCGGGCCCCCTCCCCCCGCGG + Intronic
1098161311 12:67649546-67649568 GCGCGGCCCGGCTCCCCCGCCGG + Intronic
1098819151 12:75207765-75207787 GAGCGCCCCCGCTGTCCCCCGGG - Exonic
1101949378 12:109162666-109162688 GAACTTCCCCGTTCCCCCCGGGG + Intronic
1103433143 12:120904534-120904556 GTGCCGCCCCCCTCCCCACGCGG + Intergenic
1104846805 12:131851080-131851102 GAGGGGCCCCGCGCCCCTCCAGG + Exonic
1104891834 12:132143965-132143987 GAGGGAGCCCGCTCGCCCCGCGG + Intronic
1104942241 12:132400571-132400593 CAGCGGCCCCACCCCCACCGGGG - Intergenic
1106243685 13:27928961-27928983 GCCCGGCCCTGCTCACCCCGAGG + Intergenic
1107534201 13:41311748-41311770 GAGCGGCTCGGCAGCCCCCGTGG - Intronic
1111811350 13:93096732-93096754 TAGCGCCCCCCCTCCCCCCCTGG + Intergenic
1113779716 13:112969164-112969186 GAGCCGCCCCCCGCCCCCCGCGG + Intronic
1114182422 14:20377883-20377905 CAGCGGCACCCCTCTCCCCGTGG + Intronic
1114461197 14:22887053-22887075 GAGCGGCCCCGGGCCGCCCCCGG - Exonic
1116457345 14:45134517-45134539 GAGTGGCCCCGCCCCGCCCTAGG - Exonic
1116862173 14:50003470-50003492 GGGCGTCCCCGCGCCCCCGGGGG - Intronic
1117990695 14:61430599-61430621 GAGAGGCCCCCCTCCCCCACAGG + Intronic
1121279111 14:92687109-92687131 GAGCGGCCTCGCCTTCCCCGGGG - Intronic
1122352218 14:101102872-101102894 GAGCTGCCCCGATCCCCCCAGGG - Intergenic
1123080041 14:105688078-105688100 GCGCCGCCCGGCTCCCCCCTGGG - Intergenic
1124581089 15:30955643-30955665 GTGCTGCCCCGCCCCCCCCTTGG - Intronic
1124600926 15:31132261-31132283 GAGGGGCCTCCATCCCCCCGAGG + Intronic
1125999374 15:44194921-44194943 GCGCCGCCCCGCCCCGCCCGCGG - Intronic
1127674687 15:61228482-61228504 GAGCGCCCCCTCTCCACCCCCGG + Intronic
1128582472 15:68819242-68819264 GCGCGTCCCCGGTCCCCCCAAGG + Intronic
1128992500 15:72272541-72272563 GAGCGGCCCGGGACGCCCCGCGG + Exonic
1129468743 15:75738633-75738655 GAGCGGCCCCGCCCACCCTAAGG + Intergenic
1130305402 15:82709652-82709674 GGGCGGCTCCGCTGGCCCCGGGG - Exonic
1130957181 15:88636049-88636071 GAGAGGCCCCTCTCCCCACAAGG - Intergenic
1131383018 15:91980208-91980230 GAGAGGCCTCGCTGCCCCGGTGG + Intronic
1132480581 16:164723-164745 CCGCGGCCCCGCCCGCCCCGCGG - Intronic
1132519750 16:381759-381781 CAGCGGCCCCGCCACCACCGCGG + Exonic
1132549693 16:549244-549266 GACCGGCCGCGGTCCCCGCGAGG + Intronic
1133033831 16:3023882-3023904 GAGGGGCCCAGCGCCTCCCGCGG - Exonic
1133036607 16:3036992-3037014 GAGCGCCCCGGCCCCTCCCGCGG - Intergenic
1133188392 16:4116159-4116181 GTGCGCCGCCGCTCCCGCCGCGG + Exonic
1133232094 16:4371776-4371798 GAGAGGCCCCGCCCCTGCCGCGG + Intronic
1134024646 16:10944644-10944666 GAGCGGCCCAGCGCCCGCGGCGG - Exonic
1134584048 16:15395926-15395948 GCGCGGCCCGGCGCCACCCGTGG + Exonic
1134614890 16:15643263-15643285 GCGAGGCCCCGCCCCCCCCGGGG - Exonic
1136242103 16:28951021-28951043 CAGCGGCCCCGCTTCCCCACAGG - Exonic
1138450737 16:57092457-57092479 CAGCGCCCCCGCTCCTCCCGTGG + Intergenic
1139574743 16:67833773-67833795 CAGCGGACCCGCGCACCCCGCGG - Exonic
1139924025 16:70475819-70475841 GGGGAGCCCCACTCCCCCCGCGG - Intronic
1142226759 16:88881336-88881358 GAAGGGCCCCGCTCCCGCCGCGG - Exonic
1142381337 16:89733954-89733976 GAGCGGCCCTGCCCCCACCCTGG + Exonic
1142474322 17:180601-180623 GAGCGGCCCGGCCTCCCGCGTGG - Intronic
1142509801 17:386168-386190 GGGCGGCCCCGCTTCCCCCCCGG + Intronic
1142994842 17:3754566-3754588 GAGAGGCCCCGCCCTCCCCTGGG + Intronic
1143784292 17:9245167-9245189 CAGCGGCCCCGCTGGCCCTGGGG - Intergenic
1144500858 17:15786254-15786276 GGGCCGCCCCCCGCCCCCCGCGG + Intergenic
1145163019 17:20588916-20588938 GGGCCGCCCCCCGCCCCCCGCGG + Intergenic
1145863782 17:28227543-28227565 CTGCGGCCCCGCTCCACCGGGGG + Intergenic
1146008422 17:29176841-29176863 GGGCCGCCCGGCTCCCCGCGCGG - Intronic
1147584917 17:41648513-41648535 GAGCAGACACGCTCCACCCGCGG + Intergenic
1147927179 17:43953233-43953255 CTGCGGCCCCGCTCCACCTGGGG - Intronic
1147970883 17:44218821-44218843 GAGCGGCCGCACCGCCCCCGGGG + Intronic
1148081030 17:44967825-44967847 GTGCGGCCCGGCTTCCCCTGGGG + Exonic
1150108554 17:62479006-62479028 GGCCGGTCCCGCGCCCCCCGCGG + Exonic
1151801971 17:76384216-76384238 GCGCGGCTCCGCTCTCCCGGGGG - Intronic
1151866461 17:76806387-76806409 GAGCCTCCCCGCCCCCGCCGTGG + Intergenic
1152111563 17:78359985-78360007 GCCCGGCCCAGCTCCCGCCGCGG - Exonic
1152639045 17:81442141-81442163 GGGCGGCCCCGCACCCCGAGGGG + Exonic
1152728873 17:81960406-81960428 GCGCCGCTCCGCTCCCCACGCGG + Intronic
1152816032 17:82408591-82408613 GAGGGGCCCTGCTCCCTCCCAGG + Intronic
1156350476 18:36297786-36297808 CCGCGGCCCCGCTAACCCCGGGG + Intronic
1160404635 18:78637486-78637508 GAGCGGCCCCTCTGTCCCTGTGG + Intergenic
1160561091 18:79756074-79756096 GTGCTGGCCCGCTGCCCCCGTGG - Exonic
1161171848 19:2816098-2816120 GAGCGGCCCCACTCCTCTCAAGG + Intergenic
1161241191 19:3224817-3224839 CAGCGGGCCCGAGCCCCCCGGGG + Exonic
1162024922 19:7888457-7888479 GAGCCGCCCCGCCCCGCCCCCGG - Intergenic
1162909825 19:13842776-13842798 GCCCGGCTCCCCTCCCCCCGCGG - Intergenic
1163019717 19:14475580-14475602 GAGCAGCCCCCTTCCCCCCCAGG + Intergenic
1163793372 19:19321205-19321227 GAGCGGCCCCCCACCCGCCGCGG - Intronic
1164217162 19:23160759-23160781 GAGGGGCCCCCCACCTCCCGGGG + Intergenic
1167267666 19:48491497-48491519 GAGCGTCCAGGCCCCCCCCGAGG - Exonic
1167469369 19:49666807-49666829 GAGTGGCCCTTCTCCCCCAGGGG + Intronic
1167649042 19:50719620-50719642 GAGCGCCCCCCCTTCCGCCGCGG + Intergenic
926063685 2:9820710-9820732 GAGTGGCCTCCCTCACCCCGAGG - Intergenic
926205091 2:10830101-10830123 GAGCGGCCCCTCTACCTCCCAGG - Intronic
927943318 2:27119065-27119087 CAGCGCCCCCGCTGCGCCCGCGG + Exonic
930019633 2:46993697-46993719 GTGCGGCCTCTTTCCCCCCGCGG + Intronic
931516091 2:63051435-63051457 GAGCGGCCTGGCTCCCCTCTTGG + Intronic
932773654 2:74514881-74514903 GAGCGGCCCCGAAACCCCAGGGG + Exonic
933279934 2:80322500-80322522 GGGCGGCTACGCTCCCCGCGGGG + Intronic
934763736 2:96869407-96869429 GCGCGGCCCGGCTCGGCCCGGGG + Intronic
937045649 2:118850024-118850046 GAGCGGCCCCGCGCGCCGCGCGG + Intergenic
937208672 2:120253141-120253163 CAGCGGCCCCGCTCCGCTCCGGG + Intronic
937994126 2:127680146-127680168 GTGCTTCCCCGCTCCCCCCCGGG - Intronic
938767440 2:134469658-134469680 GTGCGGCCCCTCTCTCCCCTGGG - Intronic
942446774 2:176083374-176083396 GAGCGGCGCCGAGGCCCCCGGGG + Exonic
944675976 2:202034365-202034387 GGGCCGCCTCGCTCTCCCCGCGG - Intergenic
945225713 2:207529845-207529867 GAGCGGCCCCGCCCCCGCGCTGG - Intronic
948462994 2:238139184-238139206 GAGCGCCCCCACTTCCCCTGGGG - Intronic
948988717 2:241541264-241541286 GACAGGCCCCGCCCCCGCCGCGG - Intergenic
1168757314 20:326288-326310 GCGCGGCCCCGCCCCCCCGGTGG + Exonic
1169266935 20:4172581-4172603 GAGCCGCCCTGCTCCCGGCGTGG + Intronic
1172547353 20:35772195-35772217 GCCCGGCCCCGCTCCCCGCCTGG + Intronic
1175890027 20:62311904-62311926 CAGCGGCCAGGCTCACCCCGTGG + Exonic
1175890471 20:62313706-62313728 GAGCAGCCCCTCTGCCCCAGGGG + Exonic
1180177783 21:46098604-46098626 GAGAGGCCCTGCGCCCCCGGAGG - Intronic
1183149940 22:36029028-36029050 GCCTGGCCCCGCCCCCCCCGCGG - Intergenic
1183506904 22:38214357-38214379 GGGCCCCCCCGCTCCACCCGCGG - Intronic
1183535285 22:38397851-38397873 GAGAGGCCCAGCCCCTCCCGCGG + Intronic
1184838666 22:47039648-47039670 GAATGGCCCTGCTCCCCCAGGGG + Intronic
1184890845 22:47378221-47378243 GAGCAGCCCTCCTCCCCTCGAGG - Intergenic
1185294575 22:50046834-50046856 GAGCGGCACCTCTTCCCCTGGGG + Intronic
1185313746 22:50170251-50170273 CGGCGGCCCCGCTCCCGCCGCGG - Intergenic
955195585 3:56802104-56802126 GAGAGGTCCCTCTCCACCCGCGG - Intronic
968951902 4:3699780-3699802 GAGCAGCCCCTCACCACCCGCGG - Intergenic
969239152 4:5888087-5888109 GACCGGCCCCGCCCCACCCGCGG + Intronic
969873004 4:10116416-10116438 GAGGAGCCCCGCTGCCCCCAAGG - Intronic
971195796 4:24471162-24471184 TAGCGGGCCAGCTCCCCCCGCGG + Intergenic
975633038 4:76421091-76421113 GAGCCGCCCCGCAGCCTCCGCGG - Intronic
983428979 4:167623073-167623095 GTGCGGCCCCCCTCCTCCAGTGG - Intergenic
990410757 5:55538475-55538497 TAGCTGCCCCCCTCCCCCGGGGG - Intergenic
997869928 5:137498329-137498351 GAGAGGCTCCGCGCCCCCCAGGG + Intronic
1002044970 5:176536689-176536711 GAGCCGCCCCCCTCCCCCTGCGG - Intronic
1002368455 5:178730672-178730694 GCCCGGCGCCGCTCACCCCGCGG + Exonic
1002638943 5:180621509-180621531 GCGCGTCCCCGCCCTCCCCGCGG + Intronic
1006296958 6:33174012-33174034 GTGGGGCCCCGTTCTCCCCGAGG + Exonic
1006644434 6:35506143-35506165 GAGGGCCCCGTCTCCCCCCGTGG - Exonic
1010277925 6:73990756-73990778 GAGCCTCCCCTCTCCTCCCGCGG - Intergenic
1017146405 6:151239734-151239756 TAGCCGCCCCCCTTCCCCCGGGG - Intergenic
1017672351 6:156779072-156779094 TCGCGGCCCCGCCGCCCCCGGGG - Exonic
1018017927 6:159727988-159728010 GAGCGCCGCCGCTCAGCCCGGGG - Intronic
1018914670 6:168125710-168125732 GTGTGGCCACGCTCACCCCGGGG - Intergenic
1019725269 7:2598641-2598663 GAGCAGCCCGGGTCGCCCCGGGG - Intronic
1019984006 7:4642027-4642049 GACCGGCCCCGCCACCCTCGGGG + Intergenic
1024323151 7:48089202-48089224 GAGCGGCCCCGCCCTGCCCGGGG - Exonic
1025997466 7:66537096-66537118 GAGCTGCCCTGCCCCACCCGAGG + Intergenic
1026944503 7:74307103-74307125 GAGCAGCCCCCCTGTCCCCGAGG - Intronic
1029424856 7:100488973-100488995 GGGAGCTCCCGCTCCCCCCGGGG - Exonic
1034439914 7:151081255-151081277 GGGCGGCCCGGCTCTGCCCGGGG + Exonic
1035168210 7:157003873-157003895 GAGTGGCTGCGCTCGCCCCGCGG + Intronic
1035286507 7:157810465-157810487 CAGCAGCCCCGCTGTCCCCGTGG - Intronic
1035341820 7:158167063-158167085 GAGGCCCCCAGCTCCCCCCGGGG - Exonic
1036668873 8:10766477-10766499 GAGCGGCCACGCTCCACCTTTGG - Intronic
1037581078 8:20246420-20246442 GAGCAGCCCCGCTGGCCCAGGGG + Exonic
1037754119 8:21700468-21700490 GAACAGCCCCACTCCCACCGTGG + Intronic
1037819910 8:22130582-22130604 GAGCGCCCCCGCCGCCCCGGGGG - Exonic
1037855275 8:22367195-22367217 GGCCCGCCCCGCTCGCCCCGGGG - Intergenic
1038540171 8:28385392-28385414 GTGCAGCCCCGCCCCCCCCCCGG + Intronic
1039473759 8:37828823-37828845 GAGCCGCCCTGCTCCCCGGGAGG - Intronic
1042271914 8:66963120-66963142 GACCGCCTCCGCTGCCCCCGCGG + Intergenic
1043284868 8:78516252-78516274 GAGCGGCCCCGCTCCCCCCGTGG + Exonic
1044719858 8:95134308-95134330 CGGCGGCCCCCGTCCCCCCGCGG - Intronic
1049396347 8:142402945-142402967 GCGCGGCCCCGCCCCCCGCCCGG + Intronic
1051929022 9:22363564-22363586 GAGCCTCCCCGCTCCCCGGGTGG - Intergenic
1053381159 9:37650750-37650772 GGGCGGTCCCGCTCCCACCCGGG - Intronic
1053489680 9:38489161-38489183 GAGCGGCCCTGCACCCCCTCTGG - Intergenic
1061108863 9:128552752-128552774 GAGCTGCCCAGCTCCCACCCGGG - Intronic
1061208498 9:129177594-129177616 GAGCGCCCCCGCGCCGCCCGCGG + Exonic
1061483812 9:130910221-130910243 GACCAGCCCCGCTGGCCCCGGGG + Intronic
1061666626 9:132163675-132163697 CAGGGGCCCCGCGCCCGCCGCGG + Intronic
1061876264 9:133545593-133545615 GAGAGGCCCGGCTCCCCGCTCGG - Intronic
1062242623 9:135548379-135548401 GAGCTGCCCAGGTCCCCCTGGGG + Intronic
1062305905 9:135907126-135907148 GAGCGGCCGCGCCGCCGCCGAGG - Exonic
1062490054 9:136800566-136800588 GAGCCGCCCCGCACCCGCCAGGG + Exonic
1062629850 9:137458789-137458811 GAGTGGCCTCGGTTCCCCCGGGG - Intronic
1203773981 EBV:62693-62715 GAGCGGCCACGCTTACCCGGCGG - Intergenic
1192203779 X:69082993-69083015 GCCCGGCCCCTCTCCCCCCAGGG + Intergenic
1201634877 Y:16111833-16111855 GAGAGGCCCCGCTCCCCTGCTGG + Intergenic