ID: 1043285559

View in Genome Browser
Species Human (GRCh38)
Location 8:78525151-78525173
Sequence CTGGGTAAACAGATGGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043285559_1043285571 22 Left 1043285559 8:78525151-78525173 CCATGCACCATCTGTTTACCCAG 0: 1
1: 0
2: 0
3: 21
4: 178
Right 1043285571 8:78525196-78525218 CTTTTCAACTATAGCAGATGGGG No data
1043285559_1043285570 21 Left 1043285559 8:78525151-78525173 CCATGCACCATCTGTTTACCCAG 0: 1
1: 0
2: 0
3: 21
4: 178
Right 1043285570 8:78525195-78525217 CCTTTTCAACTATAGCAGATGGG No data
1043285559_1043285568 20 Left 1043285559 8:78525151-78525173 CCATGCACCATCTGTTTACCCAG 0: 1
1: 0
2: 0
3: 21
4: 178
Right 1043285568 8:78525194-78525216 CCCTTTTCAACTATAGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043285559 Original CRISPR CTGGGTAAACAGATGGTGCA TGG (reversed) Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
902205252 1:14863747-14863769 CAGGGGAAACTGAAGGTGCACGG + Intronic
902724491 1:18325746-18325768 CTGGGAAAACAGATGGAGACAGG - Intronic
902873474 1:19327548-19327570 CTGGGTGAACAGATGGAGGGAGG - Intronic
909817929 1:80020055-80020077 CTGGGTCATCATATGGCGCAAGG - Intergenic
911370307 1:96988086-96988108 CTGGGAACACAGATGGGGAAGGG - Intergenic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
923838041 1:237636325-237636347 CTGGGTAGACACTTAGTGCATGG + Intronic
1062940218 10:1415185-1415207 GTGGGTGAACAGATGGTGGATGG + Intronic
1065204064 10:23341733-23341755 CTGGGTAGAAAGATGGTGCCTGG - Intronic
1065695301 10:28374272-28374294 CTGGGCAAAGAGAGGGTGGATGG - Intergenic
1069547800 10:69341235-69341257 CTGGGGAAGCAGAGGTTGCAGGG - Intronic
1070660252 10:78300585-78300607 CTGGGGAAACAGAAAGTGAAGGG - Intergenic
1071229164 10:83564924-83564946 CTGGTTTAACAGTTGGTGAACGG + Intergenic
1072874952 10:99162733-99162755 CTTGGTAAACTGAAGGGGCAGGG - Intronic
1076369780 10:129944979-129945001 CTTGGTAAACTGATTTTGCAAGG + Intronic
1076391897 10:130109721-130109743 GTGAGGAAAGAGATGGTGCAGGG + Intergenic
1076501913 10:130943855-130943877 CTGGGTACTCAGATGGTCCTGGG + Intergenic
1076678035 10:132158104-132158126 CTGAGTAGACAGATGCTGCCGGG - Intronic
1079011307 11:16830684-16830706 CTTGGTAAATACATGGTGAATGG - Intronic
1083826896 11:65209044-65209066 TTGGGTAGAAAGATGGGGCAGGG - Intronic
1084737402 11:71114353-71114375 CTGGGTAAAATGATGGTGCGGGG + Intronic
1086781784 11:90916035-90916057 CTGCATAAACAGAAGGTGGAAGG - Intergenic
1088871694 11:113895799-113895821 CTGGGTGAAGAGAGGGTGAACGG - Intergenic
1090408847 11:126493782-126493804 CTGGGCAAACACATGGTGACAGG + Intronic
1091076999 11:132628659-132628681 CTGGGGACACAGGTGGTGTAAGG - Intronic
1092748261 12:11693720-11693742 CTGGGGACAGAGATAGTGCAGGG - Intronic
1092865028 12:12752886-12752908 CTGGCTAAACAGATAGAGAAGGG - Intronic
1094672703 12:32586599-32586621 AAGGGAAAACAGATGGAGCAGGG + Intronic
1095734064 12:45537033-45537055 CTGGGTACACAGATAGTGCTCGG - Intergenic
1096425362 12:51497133-51497155 CCAGGTATACAGTTGGTGCAAGG - Intronic
1097309737 12:58105479-58105501 CTGTGTAGACAGATGATGCTGGG + Intergenic
1097720867 12:63019785-63019807 CTGGGCAAACGGATGGTATAGGG + Intergenic
1098771725 12:74560778-74560800 CAGGGAAAACAGAGTGTGCAGGG + Intergenic
1098780070 12:74676195-74676217 CTGGTTAGACAGTGGGTGCAGGG + Intergenic
1101225639 12:102685645-102685667 CTGGGTAAACTGATTGTTCATGG + Intergenic
1102034281 12:109761954-109761976 CTGGGGAAGCAGTTGGTGCAGGG - Intronic
1103206751 12:119135605-119135627 CTCAGTAAACACCTGGTGCATGG - Intronic
1103360973 12:120353371-120353393 CTGGGTAACCTGATGGGGCAAGG + Exonic
1106124474 13:26889087-26889109 CTGGGAAGACAGAGGTTGCAGGG + Intergenic
1106736410 13:32592089-32592111 CAGGATAAGCAGATGGTACAAGG - Intronic
1108151309 13:47537643-47537665 CTGGGGAAACAGGTGGTGTTTGG - Intergenic
1108532875 13:51343879-51343901 CTGGGAAAACAGCAGGTCCAGGG - Intronic
1108819737 13:54334153-54334175 CTGGCTAAACAGATTATGGAGGG + Intergenic
1109692311 13:65909674-65909696 CAGAGTAAACAGATGATGCTTGG - Intergenic
1110359929 13:74613087-74613109 CTGGGTCTACAGTTGGTGCACGG + Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1115343496 14:32317719-32317741 CTGGCAAACCAGATGGTGCCTGG - Intergenic
1115557449 14:34554652-34554674 CTGGGTAAATACAAGGGGCAGGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118054424 14:62064611-62064633 ATGGGGAAACAGATGGTAGAGGG + Intronic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1120706191 14:87748297-87748319 CTGGCTAATGAGATGGTGTAAGG - Intergenic
1122272991 14:100576655-100576677 CAGGGGACACAGATGGTACAGGG + Intronic
1124096006 15:26649339-26649361 CTGGGTCATCACATGGTGGAGGG - Intronic
1124973986 15:34516551-34516573 CTGGGAAAAGAGATCGTGCCCGG + Intergenic
1127266008 15:57362328-57362350 GTGGTTAAACCCATGGTGCAAGG - Intergenic
1128564550 15:68692008-68692030 CTGTGGAAGCAGATGATGCAGGG + Intronic
1129478174 15:75801805-75801827 ATGCGAAAACAGATGTTGCATGG + Intergenic
1131261957 15:90892197-90892219 GTGGGGAATCAGATGGGGCAGGG - Intronic
1131341923 15:91610631-91610653 CTTGGAAATCAGATGGTGCTAGG - Intergenic
1132712021 16:1273085-1273107 ATGGGTAGACAGATGGTAGATGG + Intergenic
1135286907 16:21201337-21201359 CTGGGTAACCTGATAGTACAGGG + Intronic
1135801793 16:25504074-25504096 CTGGGTACACATATGGAGAATGG + Intergenic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1140192533 16:72830053-72830075 CTGGGTAAACAGTTGGTATGAGG + Intronic
1140310613 16:73844810-73844832 ATGGGTAGACAGATGGTAGACGG + Intergenic
1141110140 16:81265456-81265478 GTGGGTAGATAGATGGTGGATGG - Intronic
1142144333 16:88486559-88486581 CTGGGTACACAGTGGGTGCTAGG + Intronic
1147583270 17:41638591-41638613 CTGGGTATACAGGGGGTGCTGGG - Intergenic
1148106733 17:45122864-45122886 CTGGGTAAACGGAGAGTCCATGG + Intronic
1151325971 17:73379945-73379967 CTGTGTAAAGAGTTGGTGGATGG - Intronic
1151544830 17:74786376-74786398 CTTGGTGCACAGATGGGGCAGGG - Intronic
1153660943 18:7325732-7325754 CTGAGGGAACAGAAGGTGCAAGG + Intergenic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1159655367 18:71025964-71025986 TTGTGAAAACAGATGGTTCAAGG + Intergenic
1159696800 18:71569013-71569035 TTGGGTGAACTGATGGTGAATGG + Intergenic
1160461508 18:79042194-79042216 CCGTCTAAACAGAAGGTGCAAGG - Intergenic
1161283966 19:3459444-3459466 CTGGGTAAACCGAGGGTGGGGGG + Intronic
1162119422 19:8453680-8453702 CTGGGGAAGCAGAAGGTGCAAGG + Intronic
1162143215 19:8596933-8596955 CTGAGAAAACAGATGGTCCAGGG - Intronic
1162349133 19:10138246-10138268 CTAGGGAAGCAGATGATGCAGGG + Intronic
1162966410 19:14158281-14158303 CTGGGAACACAGAGGGTACAGGG + Intronic
1163233061 19:16016704-16016726 CTGGGGATGCAGATGGGGCAGGG - Intergenic
1163508272 19:17720622-17720644 CAGGGGAAACAGCTGTTGCAAGG + Intronic
1165374336 19:35431249-35431271 GAGGGAAAACACATGGTGCAGGG - Intergenic
1165413367 19:35676033-35676055 ATGGATAGACAGATGGAGCAGGG - Intronic
1167550327 19:50155834-50155856 CGTGGGAACCAGATGGTGCAGGG - Intronic
1167851285 19:52204347-52204369 CTGGGAGATCAGATGGTGTAGGG + Intronic
1168475704 19:56673573-56673595 CTAGGGGAACAGATGGTGCTGGG + Intergenic
925470461 2:4155760-4155782 ATGGATAAACAGATGATGGATGG - Intergenic
926706226 2:15839667-15839689 CAGGATAAACAAATGGTGCATGG + Intergenic
927107635 2:19841620-19841642 CTGGGGAGACAGATAGTGTAAGG + Intergenic
933543676 2:83681431-83681453 CTGGGTAATCAGATACTGGAAGG - Intergenic
934020035 2:87939480-87939502 CTGTGTGACCAGATGGTGCTAGG - Intergenic
934508246 2:94914084-94914106 CTGGAGAGACAGAGGGTGCATGG - Intergenic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
942237831 2:173929590-173929612 CAGGCTGAACAGATTGTGCAAGG + Intronic
945524761 2:210874463-210874485 CTGTGTTATCAGATGGTGGAAGG + Intergenic
946969893 2:225079923-225079945 CAGGGCAAACAGTTTGTGCAAGG - Intergenic
948063557 2:235060280-235060302 CTGGGCACACAGAGGGTCCAAGG + Intergenic
948120710 2:235528323-235528345 CTGAGTGCACAGATGGTGGATGG - Intronic
1170268148 20:14491633-14491655 CTGGTTAAACAGATGGGCCTTGG + Intronic
1171720486 20:28557600-28557622 CAGGGAATACAGATTGTGCATGG - Intergenic
1171784803 20:29453049-29453071 CAGGGAATACAGATTGTGCATGG - Intergenic
1171863585 20:30424590-30424612 CAGGGAATACAGATTGTGCATGG + Intergenic
1172958764 20:38782179-38782201 CAGGGTGTAAAGATGGTGCAGGG + Intergenic
1173675381 20:44830323-44830345 TTACGCAAACAGATGGTGCATGG - Intergenic
1175051945 20:56163943-56163965 CTGTGTCACCAGATGGTGGAGGG - Intergenic
1175522378 20:59610177-59610199 CTGGGGAAGCAGAGGTTGCATGG + Intronic
1175649456 20:60705792-60705814 TTGAGTAAACGGATGGTGGATGG - Intergenic
1175817374 20:61890368-61890390 ATGGGTAAGCAGATGGTGGATGG + Intronic
1178788631 21:35677409-35677431 ACGGGTAAACAAATGCTGCAGGG - Intronic
1181451805 22:23027670-23027692 CAGGGTAAACAGATCTTACATGG - Intergenic
1183908358 22:41060064-41060086 CTGGATAAAAAGATTCTGCAGGG - Intergenic
1183964650 22:41434494-41434516 CTAGGGGAACAGATGGTGCTGGG + Exonic
1185013655 22:48331287-48331309 CTGGGTAGGCAGGTGGGGCAAGG - Intergenic
1185236630 22:49717314-49717336 CTGTGTAAACAGTTGTTACACGG + Intergenic
952842850 3:37662821-37662843 CTGTGTAGACAGTTGGTCCATGG + Intronic
955732449 3:62000863-62000885 CTGGGAAAGCAGATGATCCAGGG - Intronic
956604074 3:71053882-71053904 CTGGATAAATACATGTTGCATGG - Intronic
956617337 3:71185582-71185604 CTGGGTAGACAGATAGTCCCAGG + Intronic
959496762 3:107060866-107060888 CTAGGTAAAAAGAAGGTGAAAGG - Intergenic
959926525 3:111927772-111927794 CTTGATAAACAGATGGTTCAAGG - Intronic
959933194 3:112004199-112004221 CTTGGAAAACAGAAGGTGAATGG + Intronic
960195929 3:114768037-114768059 ATGGATAATTAGATGGTGCAGGG - Intronic
960449318 3:117786997-117787019 ATGGGTAAAGTGATGTTGCATGG - Intergenic
962811636 3:138963370-138963392 CTGTGTAAACAGGAGGCGCATGG - Intergenic
962938070 3:140099951-140099973 GTGGGTAATCAGGTGTTGCAGGG + Intronic
965066284 3:163854680-163854702 CTGGGTGGACAAGTGGTGCATGG + Intergenic
968614233 4:1570167-1570189 CTGGGTAGGAAGAGGGTGCAAGG + Intergenic
970213512 4:13734909-13734931 TTGGGAAAAGAGATGGTGCCTGG + Intergenic
972822589 4:42718807-42718829 CTGGGAAAACAGATGTTTCAGGG + Intergenic
975068166 4:70096405-70096427 TTGGGGAAACAGATGGTGTTTGG + Intergenic
977078929 4:92497712-92497734 CTGGAAAAAAAGATTGTGCAGGG - Intronic
979398989 4:120224497-120224519 CTGGACAAACAGATGGGGCGGGG - Intergenic
979871128 4:125823498-125823520 CTGTGTAATCACATGGTGAAAGG + Intergenic
983024903 4:162724518-162724540 CAGGGTAAACAGATGGGGGCTGG - Intergenic
985122353 4:186656605-186656627 CAGGGTAAACTGATGATGAATGG + Intronic
985325286 4:188761229-188761251 CTTATTAAACAAATGGTGCAAGG - Intergenic
986705750 5:10453332-10453354 CTGGGTAGACAGGAGGTGCTCGG + Intronic
988823367 5:34910231-34910253 CTGGGTAACGAGATGGACCATGG - Intronic
989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG + Intronic
991589011 5:68229596-68229618 CAGGGTAGACAGAGGGTGCGAGG + Intronic
993182282 5:84569849-84569871 CTGGATAAACAAATGTGGCATGG - Intergenic
994475839 5:100267861-100267883 TTGGTTAAACAGCTTGTGCATGG + Intergenic
994521242 5:100839213-100839235 CTGGGTAAATACATATTGCAAGG + Intronic
997597536 5:135117091-135117113 CTGGGCACACAGCTGGTGCCTGG - Intronic
997831138 5:137151093-137151115 CTGGTAAAATAGATGCTGCAGGG - Intronic
998585051 5:143418706-143418728 AAGGGTAAACAGTTGGTGCTGGG + Intronic
999057310 5:148592329-148592351 ATAGGTAAACATATGGGGCATGG - Intronic
999305990 5:150519950-150519972 CTGGGTGGACAGAAGGTCCAGGG + Intronic
1001335338 5:170791927-170791949 CTGTGTCATCAGATGGTGGAAGG + Intronic
1002778500 6:348838-348860 CTGGGTAAATATAAGGAGCAAGG + Exonic
1005979779 6:30828121-30828143 CTGGGTCAACAGATGGAGGCAGG + Intergenic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006445851 6:34079382-34079404 CTGGCTAAACTGTTGTTGCAGGG - Intronic
1006653965 6:35574442-35574464 ACGGGTAAACAGATTGAGCATGG - Exonic
1007105189 6:39279015-39279037 CTGGGGAAATAGGTGGTGCCAGG - Intergenic
1007375968 6:41456909-41456931 CTGGGTAAACAGCTGCTGCTGGG + Intergenic
1007397882 6:41587649-41587671 CGGGGTGTACAGATGGTGCTTGG + Intronic
1007843921 6:44738634-44738656 CAGGGTAAAAAGATGGGGCCTGG + Intergenic
1008483871 6:52014554-52014576 CTGGATAAACAGATGGATCATGG + Intronic
1008549626 6:52615239-52615261 CTGTGAAAAAATATGGTGCATGG + Intergenic
1015128684 6:129785349-129785371 CTGGGTGAACTGAGGGTGGATGG + Intergenic
1019275449 7:173269-173291 CTGTGTCCACAGATGGGGCAGGG + Intergenic
1022205384 7:28158726-28158748 TTGGGTAAACTGATGGTGAGAGG - Intronic
1022953374 7:35359899-35359921 CTGGGGGAACAGGTGGTGCTTGG + Intergenic
1023507024 7:40910413-40910435 CTGGGTCAAGAGATATTGCAAGG + Intergenic
1023620439 7:42066443-42066465 CTGGGTTAAAAGATGGGGAAAGG + Intronic
1031419802 7:121537856-121537878 CTGTGAATACATATGGTGCATGG + Intergenic
1036462153 8:8962986-8963008 CTGGGCAAAGAGAGGATGCATGG + Intergenic
1036717465 8:11139564-11139586 CTCGGAAAACAGATGCTCCAGGG + Intronic
1039561291 8:38514298-38514320 CCTGCTGAACAGATGGTGCAGGG + Intronic
1042578226 8:70246353-70246375 GTGGGGAAAAAGATGGTGTAAGG + Intronic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1044590276 8:93907618-93907640 CTAGGTAAATGGATGATGCATGG - Intronic
1044898452 8:96918542-96918564 CTGAGTAAACAGAGGGTCCTGGG - Intronic
1046271957 8:111908008-111908030 CTGGGTAAATAAAAGGTCCAAGG - Intergenic
1046429157 8:114100418-114100440 CTGATTAAACACATGGGGCAGGG - Intergenic
1046485293 8:114879726-114879748 CTGTGTAAACAGACTGTTCAAGG - Intergenic
1049736694 8:144211391-144211413 CTGGGTAAGCAAATGGTACCTGG - Intronic
1049860386 8:144894291-144894313 CTGGGCAGACAGACGGTGCTGGG - Intronic
1051062758 9:13064099-13064121 CTGAGTGAACAGATGGTGTAGGG + Intergenic
1051278378 9:15418215-15418237 CTTGGGAAACAGCAGGTGCAAGG + Intergenic
1057392709 9:94652901-94652923 CTGGGGGGCCAGATGGTGCAGGG - Intergenic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1058634573 9:107024023-107024045 TTGTGTAGACAGATGGTCCATGG - Intergenic
1060110989 9:120906050-120906072 CTGGGGAAACAGGTGGGGCAGGG - Intronic
1060371047 9:123071857-123071879 CTGGGGAAACACTTGGTGTATGG + Intronic
1061385621 9:130287754-130287776 CTGGGTAAATAGCTGGTGAATGG + Intronic
1203445593 Un_GL000219v1:52219-52241 CAGGGAATACAGATTGTGCATGG - Intergenic
1188640792 X:32501754-32501776 CTGGTGGAACAGATGGTGAATGG - Exonic
1188976651 X:36683541-36683563 CTGAGTGAGCAGATGGTGGAAGG - Intergenic
1199120606 X:144048663-144048685 TTGGGGAAACAGGTGGTGCTTGG - Intergenic
1199124490 X:144099650-144099672 CTGTGTGACCAGATGGTGCTAGG + Intergenic
1200738058 Y:6821743-6821765 TTGGGGAAACAGATGGTGTTTGG + Intergenic
1201245035 Y:11995127-11995149 CTGGTTCTTCAGATGGTGCAGGG + Intergenic