ID: 1043285571

View in Genome Browser
Species Human (GRCh38)
Location 8:78525196-78525218
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043285559_1043285571 22 Left 1043285559 8:78525151-78525173 CCATGCACCATCTGTTTACCCAG 0: 1
1: 0
2: 0
3: 21
4: 178
Right 1043285571 8:78525196-78525218 CTTTTCAACTATAGCAGATGGGG No data
1043285563_1043285571 15 Left 1043285563 8:78525158-78525180 CCATCTGTTTACCCAGGGCAGGA 0: 1
1: 0
2: 1
3: 20
4: 160
Right 1043285571 8:78525196-78525218 CTTTTCAACTATAGCAGATGGGG No data
1043285564_1043285571 4 Left 1043285564 8:78525169-78525191 CCCAGGGCAGGAAAACATGACAT 0: 1
1: 0
2: 8
3: 31
4: 249
Right 1043285571 8:78525196-78525218 CTTTTCAACTATAGCAGATGGGG No data
1043285565_1043285571 3 Left 1043285565 8:78525170-78525192 CCAGGGCAGGAAAACATGACATT 0: 1
1: 0
2: 2
3: 33
4: 354
Right 1043285571 8:78525196-78525218 CTTTTCAACTATAGCAGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr