ID: 1043286554

View in Genome Browser
Species Human (GRCh38)
Location 8:78538893-78538915
Sequence GTGTGGGTGTCTTGGCAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043286549_1043286554 9 Left 1043286549 8:78538861-78538883 CCCAGGGAAAAATGACTGGGCAT 0: 1
1: 0
2: 0
3: 13
4: 193
Right 1043286554 8:78538893-78538915 GTGTGGGTGTCTTGGCAGAAAGG No data
1043286546_1043286554 20 Left 1043286546 8:78538850-78538872 CCTACACACAACCCAGGGAAAAA 0: 1
1: 0
2: 1
3: 34
4: 250
Right 1043286554 8:78538893-78538915 GTGTGGGTGTCTTGGCAGAAAGG No data
1043286543_1043286554 25 Left 1043286543 8:78538845-78538867 CCCATCCTACACACAACCCAGGG 0: 1
1: 0
2: 1
3: 8
4: 174
Right 1043286554 8:78538893-78538915 GTGTGGGTGTCTTGGCAGAAAGG No data
1043286550_1043286554 8 Left 1043286550 8:78538862-78538884 CCAGGGAAAAATGACTGGGCATT 0: 1
1: 0
2: 2
3: 15
4: 182
Right 1043286554 8:78538893-78538915 GTGTGGGTGTCTTGGCAGAAAGG No data
1043286545_1043286554 24 Left 1043286545 8:78538846-78538868 CCATCCTACACACAACCCAGGGA 0: 1
1: 0
2: 0
3: 21
4: 183
Right 1043286554 8:78538893-78538915 GTGTGGGTGTCTTGGCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043286554 Original CRISPR GTGTGGGTGTCTTGGCAGAA AGG Intronic
No off target data available for this crispr