ID: 1043289693

View in Genome Browser
Species Human (GRCh38)
Location 8:78582062-78582084
Sequence CTGTACTAGCTGCCTGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 134}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043289693_1043289697 19 Left 1043289693 8:78582062-78582084 CCTTCTTCAGGCAGCTAGTACAG 0: 1
1: 0
2: 0
3: 5
4: 134
Right 1043289697 8:78582104-78582126 GTAGTGGGCTTCTAGCCTAGTGG No data
1043289693_1043289696 4 Left 1043289693 8:78582062-78582084 CCTTCTTCAGGCAGCTAGTACAG 0: 1
1: 0
2: 0
3: 5
4: 134
Right 1043289696 8:78582089-78582111 AAGCTGTTTACAATGGTAGTGGG No data
1043289693_1043289695 3 Left 1043289693 8:78582062-78582084 CCTTCTTCAGGCAGCTAGTACAG 0: 1
1: 0
2: 0
3: 5
4: 134
Right 1043289695 8:78582088-78582110 AAAGCTGTTTACAATGGTAGTGG No data
1043289693_1043289694 -3 Left 1043289693 8:78582062-78582084 CCTTCTTCAGGCAGCTAGTACAG 0: 1
1: 0
2: 0
3: 5
4: 134
Right 1043289694 8:78582082-78582104 CAGTTAAAAGCTGTTTACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043289693 Original CRISPR CTGTACTAGCTGCCTGAAGA AGG (reversed) Intronic
901096642 1:6686445-6686467 CTGTACTAGCTGGCCTCAGATGG - Intronic
903796691 1:25934381-25934403 CTCTACTCCCTGCCTGATGAAGG - Intergenic
904087270 1:27917760-27917782 GTGTACAACCTGCCTGGAGAGGG - Intergenic
911955306 1:104226245-104226267 CAGTAATAGGTGCCTGAAAAGGG + Intergenic
912420239 1:109537740-109537762 CTGTGCTAGCTCCCTGAAGCTGG + Intergenic
915279896 1:154815226-154815248 CTCTACCAGGTGTCTGAAGAAGG + Intronic
915455271 1:156036365-156036387 CTGTTCTCCCTGTCTGAAGAGGG - Exonic
924567499 1:245210789-245210811 CAGGACTAGCTGGCTGAGGACGG - Intronic
1065593409 10:27288752-27288774 CTGCACTTGCTTCCTGACGATGG - Intergenic
1065656963 10:27961618-27961640 CTGCACTTGCTTCCTGACGATGG + Exonic
1066448847 10:35509843-35509865 CTGTATTAGCTGTGTGAATAAGG + Intronic
1066530061 10:36327831-36327853 GTGTACCAGCTGCCTCTAGATGG + Intergenic
1067319572 10:45205330-45205352 CTGTAGCTGCTGCCTGAACATGG - Intergenic
1076367111 10:129928461-129928483 CTGTACTAGAATCCTGGAGAAGG - Intronic
1077493093 11:2871132-2871154 CTGTGCTGGCTGCCTGCAGCAGG + Intergenic
1079607739 11:22391122-22391144 CTGTAAGAGATGCCTGAGGAAGG - Intergenic
1080877763 11:36292253-36292275 TTGTTCTTGCTGCCTGAGGAAGG - Intergenic
1083826714 11:65208095-65208117 CCCTGCCAGCTGCCTGAAGAGGG - Exonic
1086599507 11:88615525-88615547 CTGTCTCAGCTACCTGAAGAAGG - Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1089905824 11:122037369-122037391 CTCTACTAGCTGAGTGACGATGG - Intergenic
1091076794 11:132626140-132626162 CTATACTAGATGCATGAACAGGG + Intronic
1091482206 12:844697-844719 CTTTACTAGAAGCCAGAAGATGG - Intronic
1091742463 12:2969628-2969650 CTGTACTACCTCCCTGTAGCAGG - Intronic
1091923561 12:4324840-4324862 CTTTACGAGCTGCCTAAAAATGG - Intronic
1093187986 12:16043538-16043560 CTCTAGTAGTTTCCTGAAGAAGG + Intergenic
1097734335 12:63165461-63165483 CTGTACTATAAGACTGAAGAAGG - Intergenic
1098706664 12:73700137-73700159 GTATACTAGCTACTTGAAGAAGG - Intergenic
1099930962 12:89074087-89074109 CTCTACTGCCTGGCTGAAGAAGG + Intergenic
1100195922 12:92244279-92244301 CTTTACATCCTGCCTGAAGATGG - Intergenic
1104277457 12:127342683-127342705 CTGTTGTAGCTACCTGAATATGG - Intergenic
1110605676 13:77429561-77429583 CTTTACCAGCAGCATGAAGAAGG - Intergenic
1111215871 13:85140303-85140325 CTTTACTAGCAGCATGAAAATGG + Intergenic
1117291341 14:54336572-54336594 CTCTACTAGCAGCATGAAAATGG + Intergenic
1117331244 14:54714016-54714038 TTGTACTAGCTGTTTAAAGAAGG + Intronic
1117886623 14:60371157-60371179 CTTTACCAGCAGCCTGAAAATGG - Intergenic
1119790021 14:77341725-77341747 CTGTATTTGCTGGCTGAAGCAGG - Exonic
1120840773 14:89083111-89083133 GTGTGGGAGCTGCCTGAAGAGGG + Intergenic
1130795223 15:87200807-87200829 CTGTGATAGCAGCATGAAGATGG + Intergenic
1132395452 15:101470138-101470160 CTGTGCTGGCTGCCAGAACAAGG + Intronic
1135218374 16:20592082-20592104 CTGTACTAGTTGCATGATGCTGG + Intergenic
1135355169 16:21762934-21762956 CTGGACCAGCTGCTTGGAGAGGG + Intergenic
1135453653 16:22579076-22579098 CTGGACCAGCTGCTTGGAGAGGG + Intergenic
1141377227 16:83542612-83542634 CTGGACTAGCTGCCAGAGCATGG - Intronic
1141799775 16:86298859-86298881 CTGTACTGGCTCCCTGGAGCCGG + Intergenic
1143887743 17:10077769-10077791 CTGCAGTAGCTTCCTGAAAAAGG - Intronic
1144526705 17:15996606-15996628 CTCTGCCAGCTTCCTGAAGAAGG - Intronic
1147335704 17:39725867-39725889 CTGTGCTGGCTGCCTGGAGGAGG + Intronic
1150373030 17:64657917-64657939 TTCTACTGCCTGCCTGAAGAGGG + Intronic
1150739131 17:67765450-67765472 CTTTACTAGCAGCATGAAAATGG + Intergenic
1150779232 17:68106195-68106217 TTCTACTGCCTGCCTGAAGAGGG - Intergenic
1151211492 17:72547808-72547830 CTTTATCAGCTGCCTGAAAACGG - Intergenic
1151992958 17:77590243-77590265 CTGTGCTGGCTACGTGAAGAGGG + Intergenic
1152968622 18:140242-140264 CTTTACTAGCAGCGTGAAAAGGG - Intergenic
1152993393 18:383749-383771 CTGTATTAGCAGCCTGAGAATGG - Intronic
1158254603 18:55531809-55531831 CTGTATTAGTTGTCTCAAGAGGG - Intronic
1159515071 18:69448056-69448078 TGGCACTAGCAGCCTGAAGAAGG + Intronic
1160194011 18:76737982-76738004 CTGTGCTTGCTGCCTGAGCAGGG - Intergenic
1161771754 19:6234541-6234563 CTGTCCTAGCTGACCCAAGAAGG + Intronic
1162609996 19:11741945-11741967 CTATACTACCTACCTGATGATGG + Intergenic
1163303604 19:16463260-16463282 CTGTCCTGGCTCCCTGAAGGTGG + Intronic
1166846580 19:45732177-45732199 CTGTTCTAGGTGCTTGAACAAGG - Intergenic
1167258689 19:48445406-48445428 TTGTAATAGCTGCCTCCAGAGGG + Intergenic
925775405 2:7330362-7330384 CTTTATTAGCAGCCTGAAAATGG + Intergenic
926133700 2:10321793-10321815 CTGTACTGCATGCCTGTAGATGG + Intronic
926516509 2:13853128-13853150 CTTTATTAGCTGCATGAAAATGG - Intergenic
928416937 2:31102086-31102108 CTTTACTAGCAGCATGAAAATGG + Intronic
929210238 2:39349010-39349032 CTCTAATATCTGCCTGAAGTTGG + Intronic
929248896 2:39731559-39731581 ATGAACTAGCTCCCTCAAGAGGG + Intergenic
932551101 2:72770078-72770100 CTCTAGTAGTTGCCTTAAGAAGG - Intronic
944332333 2:198485390-198485412 CTGAACTTCCTGCCTGAAGCAGG + Intronic
946638100 2:221752971-221752993 CTGGACTAACTTCCTGAAGCAGG + Intergenic
947789766 2:232858253-232858275 CTGTCATTGTTGCCTGAAGAAGG + Exonic
947980366 2:234403507-234403529 CTGCACTGGCCCCCTGAAGATGG - Intergenic
1171382989 20:24747279-24747301 ATGTGCATGCTGCCTGAAGAGGG - Intergenic
1171423322 20:25033351-25033373 CTGTAGTAGCTGCCTAGACATGG + Intronic
1171495726 20:25553856-25553878 CTGTACTTGCTGCCTCCAGGAGG + Intronic
1171565092 20:26175581-26175603 CTGTGCTAGCTCTCTGAAGGAGG - Intergenic
1173837735 20:46136731-46136753 ATGTTCTAGCTGCCTGATCATGG - Intergenic
1175532606 20:59684488-59684510 CTGTACTTTTTGCCTGGAGATGG + Intronic
1175699669 20:61127864-61127886 CTGCCCAAGCTGCCGGAAGAAGG + Intergenic
1175826457 20:61938940-61938962 CTGGACTGGCTGTCTGCAGAGGG - Exonic
1177110647 21:17023686-17023708 CTATATTAACTGCCTGTAGAGGG - Intergenic
1178574804 21:33776436-33776458 CTGTAGTACCTGCCTGAGGCAGG + Intronic
1182074439 22:27485748-27485770 CTTTACTAGCTGCCCCAAGATGG + Intergenic
1182367382 22:29788294-29788316 CTGTACTACCGGGCTGAAAATGG + Intergenic
1184728784 22:46361896-46361918 CTGTGCCAGCTGCCTGCAGTGGG + Exonic
950800920 3:15551310-15551332 CTTTACTAGCAGCATGAAAATGG + Intergenic
950895856 3:16450201-16450223 CTCTACTAACTGCCAGAACAAGG + Intronic
951191054 3:19772250-19772272 CTCCCCTAGCTGCATGAAGAGGG - Intergenic
954224669 3:49174086-49174108 CTCTACTACCTGCCTGCAGTGGG - Intronic
957292141 3:78291899-78291921 CTTTACTAGCAGCGTGAAAATGG - Intergenic
958119772 3:89270065-89270087 ATATACTACCTGCCTGAAGTAGG - Intronic
959501289 3:107108413-107108435 CTTTATTAGCTGCATGAAAATGG + Intergenic
961150328 3:124632324-124632346 GTGTCCTAGCTTCCTGAGGATGG + Intronic
961789454 3:129365328-129365350 CTTTATCAGCTGCCTGAAAATGG - Intergenic
963732178 3:148985248-148985270 CTGTTCTCCCTGTCTGAAGAGGG - Intergenic
965932004 3:174055677-174055699 CTCCACTAGCTGTTTGAAGATGG - Intronic
972002783 4:34059431-34059453 CTTTACTAGCAGCATGAAAATGG - Intergenic
975217991 4:71779394-71779416 TTGGAGTAGATGCCTGAAGAAGG + Intronic
981566577 4:146107973-146107995 CTGTAAGTGCTTCCTGAAGAAGG + Intergenic
982717463 4:158824063-158824085 CAGTATTAACTGCCTGAAAAAGG + Intronic
984326981 4:178267819-178267841 CTGTATTAGCAGCATGAAAATGG - Intergenic
984842048 4:184077767-184077789 CTTTAGTATATGCCTGAAGAGGG + Intergenic
985104718 4:186489297-186489319 CAGCACTATCTGCCTAAAGATGG + Intronic
986130939 5:4929343-4929365 CTGTAATCCCTGTCTGAAGAGGG + Intergenic
986184625 5:5423717-5423739 CTCTCCTAGCTGCCTGATGTCGG + Intronic
989408684 5:41091838-41091860 CTGAATGAGCTGACTGAAGAAGG + Intergenic
990077723 5:51872279-51872301 CTGTATTAGCAGCATGAAAATGG + Intergenic
990909131 5:60836544-60836566 CAGCACTGTCTGCCTGAAGAAGG + Intronic
995963754 5:117878438-117878460 GTGTACTAGCTGTATGAACATGG + Intergenic
1001995545 5:176154571-176154593 CTGTGCAAGGTTCCTGAAGATGG - Intergenic
1002418038 5:179130966-179130988 CTGTACCACTTGCCTGAAGCAGG - Intronic
1012249292 6:96961840-96961862 CTGCAACAGCTGCCTGAAGAGGG - Intronic
1014940911 6:127437599-127437621 CTGTCCTAGTTGCCTGCAAATGG + Intergenic
1016603455 6:145890239-145890261 TTCTACTAGCTGCCTGACTATGG + Intronic
1019754735 7:2760699-2760721 CTGGATAAGCTGCCTGTAGAAGG - Intronic
1020659588 7:10966299-10966321 CAGGACTACCTGCCTGAGGATGG - Intergenic
1020746451 7:12085090-12085112 CTGTGCTAGCTTTCTAAAGAAGG - Intergenic
1024434299 7:49331644-49331666 CTGTGTTAGCTTGCTGAAGATGG - Intergenic
1029575543 7:101401133-101401155 CAGAACTACCTGCCTGGAGAAGG + Intronic
1032417781 7:131750646-131750668 CTGTACCAGTTTCCTGAATAAGG + Intergenic
1033453040 7:141478464-141478486 CTATACTACCTTCCTGAAGCTGG - Exonic
1040866587 8:52054155-52054177 CTATACTAACTGTCTAAAGAAGG - Intergenic
1043289693 8:78582062-78582084 CTGTACTAGCTGCCTGAAGAAGG - Intronic
1044928309 8:97228144-97228166 CTTTATTAGCAGCCTGAAAACGG - Intergenic
1047993076 8:130306931-130306953 CTGTACTAGCTCCCTCAGTATGG + Intronic
1049607020 8:143534488-143534510 CTCTACTAGAGGCCTGAAGAGGG + Intronic
1051144988 9:14017339-14017361 CTGACCTAGTAGCCTGAAGATGG - Intergenic
1056572087 9:87825114-87825136 CTGTAGAAGCTGACTGGAGAAGG - Intergenic
1057095248 9:92301322-92301344 CTCTACTAGCTGCCATATGAAGG - Intronic
1058255847 9:102761986-102762008 TTGTTCTAGCTGCCTAAAGTTGG + Intergenic
1058666484 9:107322021-107322043 CAGTACTAGCTGCTTGAGGGGGG - Exonic
1058705223 9:107632208-107632230 CTGTGCCAGCTCCCTGAAGCAGG + Intergenic
1060157888 9:121332587-121332609 CTGAGCTGGCTGCCTGAGGAGGG + Exonic
1060246241 9:121948834-121948856 CTGCACTAGCTTCCTGCAGTGGG - Intronic
1186142780 X:6594482-6594504 CTTTATTAGCAGCCTGAAAATGG - Intergenic
1186851890 X:13588605-13588627 CTGATCTAGATGCCTGAAAAAGG - Intronic
1192419441 X:71016067-71016089 GTGTACTAGCTGCCTGATCATGG - Intergenic
1193151273 X:78127156-78127178 CTCTACTAGCTTCCTGAGAAAGG + Exonic