ID: 1043294216

View in Genome Browser
Species Human (GRCh38)
Location 8:78644476-78644498
Sequence CAGGGTCACCACTTGCAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043294216_1043294222 12 Left 1043294216 8:78644476-78644498 CCAACCTGCAAGTGGTGACCCTG No data
Right 1043294222 8:78644511-78644533 TTAAGTTAAACGCATGGAGTAGG No data
1043294216_1043294220 6 Left 1043294216 8:78644476-78644498 CCAACCTGCAAGTGGTGACCCTG No data
Right 1043294220 8:78644505-78644527 TTGCCTTTAAGTTAAACGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043294216 Original CRISPR CAGGGTCACCACTTGCAGGT TGG (reversed) Intergenic
No off target data available for this crispr