ID: 1043295335

View in Genome Browser
Species Human (GRCh38)
Location 8:78654629-78654651
Sequence CCCAGTGTGTACCCCAAGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043295335_1043295341 -9 Left 1043295335 8:78654629-78654651 CCGGACTTGGGGTACACACTGGG No data
Right 1043295341 8:78654643-78654665 CACACTGGGTGGTGTGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043295335 Original CRISPR CCCAGTGTGTACCCCAAGTC CGG (reversed) Intergenic
No off target data available for this crispr