ID: 1043298503

View in Genome Browser
Species Human (GRCh38)
Location 8:78697413-78697435
Sequence TTTGACTTTTTAAGTGCGGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043298503_1043298509 28 Left 1043298503 8:78697413-78697435 CCACCCGCACTTAAAAAGTCAAA 0: 1
1: 0
2: 0
3: 2
4: 123
Right 1043298509 8:78697464-78697486 TCACGATTACCGCAGCCAAGTGG 0: 1
1: 0
2: 0
3: 1
4: 33
1043298503_1043298507 1 Left 1043298503 8:78697413-78697435 CCACCCGCACTTAAAAAGTCAAA 0: 1
1: 0
2: 0
3: 2
4: 123
Right 1043298507 8:78697437-78697459 TCTCCTGGAACTGCATCATCAGG 0: 1
1: 0
2: 0
3: 16
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043298503 Original CRISPR TTTGACTTTTTAAGTGCGGG TGG (reversed) Exonic
901346030 1:8543378-8543400 TTTGTCTTTATAAGTGCAGTAGG - Intronic
901558747 1:10052721-10052743 ATTGACTTTTTCTGTGTGGGTGG + Intronic
908775682 1:67637776-67637798 TTTGACTTTTTAAATCAGGTTGG - Intergenic
909354746 1:74695879-74695901 TTTGACTTTTTTTTTGGGGGGGG + Intergenic
919270035 1:195329555-195329577 TTTGCCTTTTTAAGTGAGTAAGG + Intergenic
921190653 1:212705158-212705180 TTTGACTTTTTAACTGCTATTGG + Intergenic
922085928 1:222346891-222346913 TTTGTATTTTTAGTTGCGGGAGG + Intergenic
1069086327 10:64143897-64143919 TTATATTTTTTAAGTGGGGGTGG - Intergenic
1069669758 10:70191990-70192012 TTTCACTCTTTAAGTGCTGTGGG + Intergenic
1072991552 10:100200253-100200275 TTTGTCTTTTTAAGTGTCTGTGG - Intronic
1076799975 10:132816813-132816835 GTTGAATTTTCAAGTGCGCGAGG + Intronic
1083560898 11:63671989-63672011 TTTGACTTCATAAGGGCAGGTGG + Intergenic
1086813049 11:91334937-91334959 TTTGTCTTTTTAAATGAGAGAGG - Intergenic
1086941725 11:92805134-92805156 TTTGTTTTTTTAACTGCAGGAGG + Exonic
1087364702 11:97203238-97203260 TTTGGTTTTTCAAGTGCGAGAGG + Intergenic
1087993708 11:104777746-104777768 TTGGACATTTAAATTGCGGGTGG - Intergenic
1089725087 11:120470138-120470160 TTTGTCTTCTTAAGTGCAGTAGG + Intronic
1091902539 12:4156094-4156116 TTGTACTTTGTAAGTGCTGGTGG + Intergenic
1097909542 12:64955021-64955043 TTGGATTTTTTAAGTGCAGGAGG - Intergenic
1098497969 12:71158672-71158694 TTTGAATTTTTTTGTCCGGGAGG - Intronic
1098602569 12:72349539-72349561 TTTGCCTTTTTTTGGGCGGGGGG + Intronic
1098825811 12:75296100-75296122 ATTGACTTTTTAGTTGAGGGAGG + Intronic
1102330811 12:112028573-112028595 TTTAATGTTTTAAGTGTGGGGGG - Exonic
1102833786 12:116033945-116033967 TTTGACTGTTTGAGTGAGGCTGG - Intronic
1106306666 13:28517214-28517236 TCTGTCTTTTTAATTGCGTGAGG - Intergenic
1107321650 13:39195368-39195390 TTTGACTGTTTAAGCGCTGGTGG + Intergenic
1116228058 14:42178561-42178583 TTTGGCTATTTAAGTGTGTGTGG - Intergenic
1117080101 14:52142942-52142964 TTTGACCTTTTGAGTGGTGGTGG - Intergenic
1118083912 14:62393854-62393876 TTTGGCTTTTTGTGTGCTGGGGG + Intergenic
1124065495 15:26340076-26340098 ATTGACTTTTTAAGAGGAGGTGG + Intergenic
1126228128 15:46295240-46295262 TTTGACTTTTTATGTGAAGTAGG - Intergenic
1126471174 15:49012643-49012665 TTTACCTTTTTAAGTGCTGTGGG + Exonic
1127419519 15:58791443-58791465 TTTGAATTTTTAAGTGGAGATGG - Intronic
1127621690 15:60740255-60740277 TTTTTCTTCTGAAGTGCGGGGGG - Intronic
1127662828 15:61116056-61116078 TTTGTTTTTTTAAGTGCTGAAGG - Intronic
1128305961 15:66599150-66599172 TTTTACTTTTTAAATGTGGCAGG - Intronic
1129793573 15:78359264-78359286 TTTGTTTTTTTAAGTGAGTGGGG + Intergenic
1130810823 15:87376766-87376788 TTTTAATTTTTAAGTTCGGAGGG - Intergenic
1131313777 15:91314475-91314497 TTTGAATATTTAGGTGTGGGAGG + Intergenic
1133067757 16:3221379-3221401 TTTGTTTTTTTAAGTGTAGGTGG - Intergenic
1139162828 16:64532523-64532545 GTTAACTTTTTATGTGCGTGGGG + Intergenic
1140133166 16:72182199-72182221 CTTGACTTTTGAAGTGCCTGAGG - Intergenic
1145723449 17:27093422-27093444 TCTGACCTTTTAAGTTTGGGTGG + Intergenic
1162636725 19:11974596-11974618 TTTGCCTTTTTTTGGGCGGGGGG + Intronic
1163715952 19:18872277-18872299 TTTGCCTTTTGAGGTGTGGGTGG + Intronic
929841688 2:45472475-45472497 TTTGTCTTTTTAAGAGATGGGGG + Intronic
931791012 2:65664256-65664278 CTTGACTTTTTTAGTGGGGCGGG + Intergenic
933349442 2:81135790-81135812 TTTGTCTTTCTAAGTGGGAGAGG - Intergenic
938311025 2:130288204-130288226 TTTGAATTTTTAAGTACAGAGGG + Intergenic
939345355 2:140958818-140958840 TTTTATTTTTTCAGTGGGGGTGG - Intronic
941949455 2:171138757-171138779 TTTGGCTTGTTAAGTAGGGGTGG - Intronic
942084645 2:172432644-172432666 TTTGATTTTTCAAAGGCGGGGGG + Intronic
944899316 2:204198208-204198230 TATGACTTTTTAAGTTTGGATGG + Intergenic
1172530550 20:35627970-35627992 TTTTATTTTTTAAGTGACGGGGG - Intronic
1174961497 20:55162243-55162265 TTTGACTTTTTAGTTGCTGCTGG + Intergenic
1176221179 20:63969946-63969968 TTTGACAGTTTTACTGCGGGGGG + Intronic
1177893229 21:26832519-26832541 TTTGTCTTTTCAAGTGGGAGAGG - Intergenic
1179958625 21:44755672-44755694 TTTGAATTTTTACGGGGGGGGGG - Intergenic
1185156245 22:49195157-49195179 TTTGACTTTTATAGGGAGGGAGG + Intergenic
950146386 3:10653105-10653127 TTTGACTTTTTTATTGAGGTGGG - Intronic
952113416 3:30150980-30151002 TTTGAATTTGCAAGTGCGAGAGG - Intergenic
956319911 3:67985276-67985298 TTTAACTTTTTATGCCCGGGAGG + Intergenic
958171615 3:89946770-89946792 TTTGTCTTTCTAAGTGGGAGAGG - Intergenic
959668233 3:108944896-108944918 TTTCTCTTTTTAAGTGCAAGTGG - Intronic
959716690 3:109441458-109441480 TTTCACTTTTTATATGGGGGAGG - Intergenic
960379128 3:116938730-116938752 TTTGTCTTTCTAAGTGGGAGAGG - Intronic
961242875 3:125427358-125427380 TTTTAACTTTTAAGTTCGGGGGG - Intergenic
961973009 3:130990276-130990298 TTTGCCTTTTTTTGTGGGGGGGG - Intronic
973050099 4:45585646-45585668 TTTGGCTTCTTTAGTGCTGGGGG + Intergenic
974116819 4:57589280-57589302 TTTCACATATTAATTGCGGGTGG - Intergenic
976159396 4:82182986-82183008 ATTTATTTTTTAAGGGCGGGGGG - Intergenic
977637509 4:99316474-99316496 TTTGAGTTTATAAGTGCCTGAGG + Intronic
978428913 4:108611935-108611957 TTTTACTTTTCATGTGGGGGTGG + Intergenic
981057271 4:140375713-140375735 TTTGATTATTTAAGTCCAGGAGG - Intronic
981758216 4:148164620-148164642 ATTAACTTTTTAACTGAGGGAGG - Intronic
982162028 4:152579857-152579879 TTTTACTTTTTAAATGCATGTGG + Intergenic
982540023 4:156657014-156657036 TCTCACTTTTTTAGTGAGGGTGG + Intergenic
982614354 4:157622147-157622169 TCTGACTTTTTTTTTGCGGGGGG + Intergenic
982812218 4:159840118-159840140 TTTGACTTCTTATTTGGGGGGGG + Intergenic
984464001 4:180074573-180074595 TATGCCATTTTAAGTGCTGGAGG + Intergenic
984783903 4:183551328-183551350 CTTGGCTTTTTCAGTGCAGGAGG + Intergenic
986246671 5:6013342-6013364 TTTGCCTTTTTTTGTGGGGGCGG - Intergenic
990353673 5:54943769-54943791 TTTGACATTTTAAAGGAGGGAGG - Intergenic
993481076 5:88425159-88425181 TTGGACATTTTAAGTTCAGGAGG + Intergenic
996274751 5:121651350-121651372 TTTTACTTTTTTGGTGGGGGTGG - Intergenic
996411586 5:123164706-123164728 TTTGACTTTTTGCGTGCTGTAGG + Intronic
998936598 5:147235535-147235557 TTTTATTTTTTAAGTCCTGGGGG - Intronic
1001798991 5:174527153-174527175 TTTGACATTTTTAATGCGGCTGG + Intergenic
1004130323 6:12913295-12913317 TTTGACATTTTAAGTGCTCTTGG - Intronic
1010704171 6:79088180-79088202 TTTGATCTTTAAAGTGGGGGAGG - Intergenic
1013268862 6:108527292-108527314 TTTGACGTTGTTAGTGTGGGTGG - Intergenic
1013987352 6:116211102-116211124 TTGGACTTCTTAAGTGGCGGTGG - Intronic
1014790437 6:125666212-125666234 TTTGAGTTGTTAGGTGGGGGCGG - Intergenic
1016320709 6:142842530-142842552 TGTGACTTTCAAAGTGCGGATGG - Intronic
1016494638 6:144646664-144646686 TTTGAATTTTTATGTGTGAGAGG - Intronic
1017634004 6:156425841-156425863 TTTGACTTTTTAAGTGTTTTTGG - Intergenic
1017833701 6:158156422-158156444 TTTGTCTTTTTATGTGGGGAGGG - Intronic
1018997040 6:168717751-168717773 TTTGAAGTTTTAAGTGAGGCTGG - Intergenic
1019200802 6:170313292-170313314 TTTCACTTTTTAGGCGGGGGAGG + Intronic
1021769284 7:23982784-23982806 TTTGTCTTTGTAAGTGCAAGAGG - Intergenic
1027483362 7:78727651-78727673 TTTGACTTTTTAAATGTGAATGG + Intronic
1030099156 7:105929946-105929968 TTTGACTGTTTAAGTGAGTAAGG + Intronic
1030748770 7:113203256-113203278 TTTGACTTTTGAGCTGCAGGAGG + Intergenic
1031337752 7:120557540-120557562 TTTGACTTTTTACATGAGGAGGG - Intronic
1031473336 7:122192859-122192881 TTTGACTTTTTACATGCTGTTGG - Intergenic
1033492421 7:141856299-141856321 TTTGTCTTTCTAAGTGAGAGAGG + Intergenic
1036844135 8:12150608-12150630 TTTGTCTTTTCAAGTGCAAGAGG + Intergenic
1038235270 8:25746730-25746752 TTTCAGTTTTTAAGTTCAGGGGG + Intergenic
1041997274 8:64078293-64078315 TATGATTTTTTAAGTGTGTGTGG - Intergenic
1043298503 8:78697413-78697435 TTTGACTTTTTAAGTGCGGGTGG - Exonic
1044942262 8:97355115-97355137 TTTCACTTTTTAAGTTTTGGGGG + Intergenic
1045458831 8:102409393-102409415 TTTGACTTTTTAAGAGGATGTGG + Intronic
1048772992 8:137915223-137915245 ATTGACTTTTTCAGTGTGGCGGG - Intergenic
1050347288 9:4703601-4703623 TGTGACATTTTAATTGCAGGAGG - Intronic
1051384498 9:16493386-16493408 TTTGAATTTTTAATTAGGGGTGG + Intronic
1055470409 9:76604983-76605005 TTTTTTTTTTTAAGTGCTGGAGG - Intergenic
1055638279 9:78298193-78298215 TTTGCCTTCTTCACTGCGGGTGG - Intronic
1056168286 9:83958980-83959002 TTTGACTTTTTGGGTGGGAGGGG - Intergenic
1057116736 9:92530708-92530730 TTTGACTTTTTAGATTCAGGAGG + Intronic
1057435563 9:95037225-95037247 TTTGATTTTTTAAAGGGGGGTGG + Intronic
1057687006 9:97243845-97243867 TTTGACTCTTTAAGTGGTGTCGG - Intergenic
1186052437 X:5612599-5612621 TTAGACTTGTTGACTGCGGGTGG - Intergenic
1188931899 X:36122252-36122274 TTTGATTTTTAAATTGCTGGGGG + Intronic
1190778258 X:53572629-53572651 TTAGATTTTTTAAGTGAGTGGGG - Intronic
1194824033 X:98539968-98539990 ATTGACTTTTGAAGTAGGGGTGG - Intergenic
1200397516 X:155999817-155999839 TTTGTCTTTTTTAATGGGGGCGG - Intronic