ID: 1043298504

View in Genome Browser
Species Human (GRCh38)
Location 8:78697416-78697438
Sequence GAATTTGACTTTTTAAGTGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 274}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043298504_1043298509 25 Left 1043298504 8:78697416-78697438 CCCGCACTTAAAAAGTCAAATTC 0: 1
1: 0
2: 3
3: 25
4: 274
Right 1043298509 8:78697464-78697486 TCACGATTACCGCAGCCAAGTGG 0: 1
1: 0
2: 0
3: 1
4: 33
1043298504_1043298507 -2 Left 1043298504 8:78697416-78697438 CCCGCACTTAAAAAGTCAAATTC 0: 1
1: 0
2: 3
3: 25
4: 274
Right 1043298507 8:78697437-78697459 TCTCCTGGAACTGCATCATCAGG 0: 1
1: 0
2: 0
3: 16
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043298504 Original CRISPR GAATTTGACTTTTTAAGTGC GGG (reversed) Exonic
900963196 1:5938929-5938951 GAATTTGACATTTTCATTGACGG + Intronic
902365696 1:15972433-15972455 GATTGTGACTGTTTCAGTGCTGG - Intronic
905234895 1:36539358-36539380 GAATTAAACTTCTTAAGGGCAGG + Intergenic
905908701 1:41639079-41639101 AAATTTGACTTTCCATGTGCCGG - Intronic
906008156 1:42496834-42496856 GAATTGGACTTTTTGAGTGTAGG - Intronic
908135001 1:61122769-61122791 TAATTTAAATTTTTAAGTTCTGG + Intronic
909287854 1:73843859-73843881 GGTTTTGACTATTAAAGTGCTGG - Intergenic
910021589 1:82596658-82596680 TAATTTTACTTTTAAAGTGGTGG - Intergenic
912084988 1:105989487-105989509 AAATTTGACTTTTTAAATTTAGG - Intergenic
912113137 1:106368715-106368737 GATTTTGATTTTTTTAGTTCAGG + Intergenic
912686024 1:111765831-111765853 GAATTTGCTTTTTTAAGGGTTGG - Exonic
913706316 1:121427555-121427577 GAATTTGAATTCATAAGTGATGG - Intergenic
914871734 1:151480721-151480743 GAATCAGAGTTTTTTAGTGCTGG - Intergenic
915819962 1:159012592-159012614 GAAATTTCCTGTTTAAGTGCTGG - Intronic
916060895 1:161098115-161098137 GATTTTGACATTTGAGGTGCAGG - Intergenic
916773932 1:167939807-167939829 GAATTTGACTTTTAAAAGGAAGG - Intronic
916784008 1:168070174-168070196 GAAATTGTCTTTTTGATTGCTGG - Intronic
917711331 1:177688253-177688275 GAGTTTGACTTTTCACCTGCTGG + Intergenic
918710883 1:187728527-187728549 GACTTTGACTTTGTAAGAGGAGG + Intergenic
918716324 1:187791522-187791544 GAATGTGAATTTTTAAATGTTGG + Intergenic
919338610 1:196272767-196272789 GAATTTGACTTTTTGAGAGAAGG - Intronic
919375386 1:196787021-196787043 GACTTTTACTTTTTAAGTAAAGG + Intronic
919893462 1:201993106-201993128 GAAGATAACTTTTTAAGTGGAGG - Intronic
921078563 1:211720446-211720468 GAATTTTACTTTTTGGATGCTGG + Intergenic
921166184 1:212508905-212508927 GATTTTGAGTTTTTGAGTCCTGG + Intergenic
921569191 1:216758630-216758652 GAATTTGACTTTCTCAGTATTGG - Intronic
1063331087 10:5160062-5160084 GCGTTTGACTTTGTAAATGCTGG + Intergenic
1064675194 10:17753266-17753288 GACTTTTAACTTTTAAGTGCAGG + Intronic
1065159721 10:22907713-22907735 GAATTTGAATGTTAAAGAGCAGG + Intergenic
1065239601 10:23693139-23693161 GAATTTGAATTTTCAAATGCGGG + Intergenic
1065775764 10:29118791-29118813 GAATTTAATTTTTTAAATACAGG + Intergenic
1065786029 10:29215920-29215942 GCATTTGACTTTTTAAGAGAAGG - Intergenic
1067117264 10:43445406-43445428 GAATTTTACTTTTTGGATGCAGG + Intronic
1067973013 10:50992599-50992621 GGATTTGTCTCTTAAAGTGCCGG - Intronic
1068513196 10:57992613-57992635 GAATGTGTTTTTTTAGGTGCTGG - Intergenic
1068849316 10:61718545-61718567 GAATTTGAGTGTTTATATGCAGG + Intronic
1069216445 10:65827212-65827234 GAATTTCACTTTGTAAGTGCTGG + Intergenic
1071263982 10:83947465-83947487 GAATTTCCCTTTTTAAAGGCTGG + Intergenic
1072465542 10:95658841-95658863 AAACATGACTTTTTAAGTGCTGG + Intergenic
1072490539 10:95901400-95901422 AAATTATACTTTTTAAGTTCTGG - Intronic
1073370511 10:102984470-102984492 GAATTTTAATTTTTAAGTGATGG + Intronic
1073828196 10:107350585-107350607 GAATTTTACTTTTTGTGTGCTGG - Intergenic
1075172798 10:120131514-120131536 GAAATTGACTATTGTAGTGCAGG - Intergenic
1078199906 11:9171529-9171551 GAATTTTACTATTTGAGTCCTGG - Intronic
1078554789 11:12314279-12314301 GAAATTGAATTTTTAAATTCCGG - Intronic
1079468211 11:20753540-20753562 TAATTTGTATTTTTAGGTGCCGG + Intronic
1080034305 11:27696509-27696531 GAATTCTAGGTTTTAAGTGCTGG - Intronic
1083560897 11:63671986-63672008 GATTTTGACTTCATAAGGGCAGG + Intergenic
1083979860 11:66158267-66158289 GAATTTGTTTTTCAAAGTGCAGG - Intronic
1085771982 11:79333790-79333812 GAGTCTTACTTTTTAATTGCTGG - Intronic
1086118876 11:83285478-83285500 GATTTTGTTTTTTTAGGTGCTGG - Intronic
1086265731 11:84995625-84995647 GAATTTGAATTTTTAATTCTTGG + Intronic
1086948997 11:92871957-92871979 TAATTTTTTTTTTTAAGTGCAGG - Intronic
1086977698 11:93155584-93155606 TAATTTGACTTTTAAAGTTCAGG + Intronic
1087487491 11:98774753-98774775 TAATTTGATTTTTTAAATGTGGG - Intergenic
1087756825 11:102063272-102063294 GAATTTGACTTTCTACGTTAAGG + Intronic
1088148296 11:106712565-106712587 AAATTTGACTTCTTAAGTGCTGG + Intronic
1089017343 11:115177178-115177200 GAATTTGACATTATAATAGCAGG + Intronic
1090554316 11:127857643-127857665 GAACTTGACTTGGTAAGTGATGG + Intergenic
1092647372 12:10590779-10590801 GATTTTGAGTTCTTAAGTGGGGG - Intergenic
1093500553 12:19806816-19806838 TAATTTTAATTTTTAAGTTCTGG + Intergenic
1094567366 12:31611787-31611809 TAGTTGGACTTCTTAAGTGCAGG + Intergenic
1094718513 12:33036503-33036525 GATTTTGACTGTTGAAGAGCTGG + Intergenic
1094767113 12:33609551-33609573 GAAACTGACATTTTAAGTGATGG - Intergenic
1094785521 12:33844066-33844088 AAATTTAACTTTTTAAATTCAGG - Intergenic
1095789951 12:46155260-46155282 TAATTTGGCTTTTCAAGTGCCGG + Intergenic
1097404279 12:59170273-59170295 CAATTTGACTTTTAAAATGAAGG - Intergenic
1097710246 12:62909804-62909826 GAAGGTGATGTTTTAAGTGCTGG - Intronic
1097909543 12:64955024-64955046 TATTTGGATTTTTTAAGTGCAGG - Intergenic
1098467676 12:70806486-70806508 GAGTTTGATTTTGTAAGTTCTGG + Intronic
1098879808 12:75905521-75905543 GACTTTTTCTTTTTAAGTTCAGG + Intergenic
1098980238 12:76948043-76948065 TAATTTGACTTTATAATGGCAGG + Intergenic
1100563552 12:95772955-95772977 GATTTTGAGATTTTAAGTGGTGG - Intronic
1101518602 12:105460726-105460748 GAATTTGACTTTCTATTTCCTGG - Intergenic
1102659117 12:114509893-114509915 TAATTTTATTTTTTAAGTTCCGG - Intergenic
1107321649 13:39195365-39195387 ACATTTGACTGTTTAAGCGCTGG + Intergenic
1107649603 13:42531235-42531257 GTAATTGACTCTTTGAGTGCTGG + Intergenic
1109618925 13:64875080-64875102 GAATTTAAATTTTTAAGTTTTGG - Intergenic
1109676624 13:65684726-65684748 AAATTTGACTTGTTCATTGCTGG + Intergenic
1110198859 13:72824445-72824467 GAATAAGAGTTTATAAGTGCAGG + Intronic
1110830163 13:80021668-80021690 CAAATGGACTTTTTAAGTACTGG - Intergenic
1111693090 13:91589665-91589687 GAAGTTGACTTTTTGAGTGAAGG - Intronic
1112895548 13:104295529-104295551 GAATTTGTGTGTTTAAGGGCAGG - Intergenic
1113230593 13:108209866-108209888 GAATTGGACATTTTAATTGTTGG - Exonic
1113274453 13:108713082-108713104 GTATTTGCCTTTATAAGAGCTGG - Intronic
1114155776 14:20101414-20101436 GGGTTTCACTTTTTCAGTGCTGG - Intergenic
1114643943 14:24243072-24243094 GTATTTTATTTTTTAAGGGCGGG - Intergenic
1114825959 14:26080067-26080089 TACATTGACTTTGTAAGTGCTGG - Intergenic
1115083834 14:29489868-29489890 GAATTTGAATTTCTAAATACAGG - Intergenic
1116291823 14:43053124-43053146 AAATTAGACTTTTCAAGTGCTGG + Intergenic
1116789144 14:49320957-49320979 TAATTTGAGTTTATAAGTGTTGG - Intergenic
1117386876 14:55223828-55223850 GACTTGGCCTTTTAAAGTGCTGG + Intergenic
1120134166 14:80845511-80845533 TCATTTGACTTTCTAAATGCAGG + Intronic
1120519476 14:85509839-85509861 TAACTTGACTCTTTAAGTTCAGG - Intergenic
1121888334 14:97565163-97565185 GAATATGATTTTATGAGTGCAGG + Intergenic
1124604103 15:31158118-31158140 TAATTTTACTTCTTAAGTGAGGG + Intronic
1126424039 15:48506315-48506337 CAATTTGCCTTTTTAAGGTCAGG - Intronic
1126906228 15:53369283-53369305 GCTTTTTACTTTTAAAGTGCTGG - Intergenic
1128860316 15:71065088-71065110 TAATTTTAATTTTTAAGAGCTGG + Intergenic
1130003661 15:80070964-80070986 GAACTTGACTCATGAAGTGCTGG + Intronic
1133783128 16:8954512-8954534 GGATTTGACTTTTTGAGTTACGG - Intronic
1133861686 16:9601263-9601285 GAATTTGTCTTTTTCAGTTAAGG - Intergenic
1134848839 16:17463900-17463922 GGATTTCACTTTTTAACAGCTGG - Intronic
1135461657 16:22649237-22649259 GAACTGGACTTTCTAAATGCTGG - Intergenic
1136100368 16:27990726-27990748 GAATTAGACTTTTAAAGGTCTGG - Intronic
1140779399 16:78280972-78280994 GGATTTGACATTTTCAGTGATGG + Intronic
1141750869 16:85957066-85957088 GAATTTGACTTTATTCCTGCCGG + Intergenic
1143271746 17:5680926-5680948 GCATTTGACATTGTAAGTCCTGG - Intergenic
1144268838 17:13598487-13598509 GAATTTAATTTTCTAAGTGTTGG - Intronic
1145715572 17:27016914-27016936 AAATTTTACTTTTTAACTACTGG - Intergenic
1145988209 17:29061721-29061743 GAATTTGGTTTTTTAAGTGGTGG + Intergenic
1149083288 17:52683983-52684005 TAATTGGACATTTTAAATGCTGG + Intergenic
1150357742 17:64502318-64502340 GAATTTAACTTTTTCATTTCTGG - Intronic
1150575107 17:66423822-66423844 GAATTCAATCTTTTAAGTGCCGG + Intronic
1151014443 17:70537836-70537858 GAATTTGCCTTTTAAATTGAGGG - Intergenic
1151892408 17:76958533-76958555 GGATTTGGCTTTTGGAGTGCTGG + Intergenic
1154292331 18:13119972-13119994 GAAAATGACTGTTTAACTGCAGG - Intronic
1154350246 18:13577007-13577029 GGACTTCACTTTTTAAGTGTTGG - Intronic
1154472389 18:14717158-14717180 AAATTTTACTTTTTAACTCCTGG + Intergenic
1156497048 18:37532594-37532616 GGATTTGACTTTTTATGTTCTGG + Intronic
1156556450 18:38074182-38074204 AAATTTGACTTTTTAAATGGTGG - Intergenic
1158838907 18:61362145-61362167 TAATTTCGCTTTTTAAGTGATGG - Intronic
1159513838 18:69432191-69432213 GCATTGGTCTTTTAAAGTGCTGG - Intronic
1165269269 19:34690918-34690940 AAATTTAATTTTTTAGGTGCTGG + Intergenic
1167917929 19:52757232-52757254 GCCTTTGCCTTTCTAAGTGCTGG - Intergenic
1168133204 19:54333923-54333945 GAATCTGACTTCTTTTGTGCTGG + Exonic
926553285 2:14326604-14326626 AAATTTGACTTAATAAGTTCTGG + Intergenic
927379012 2:22455707-22455729 GAATTTAAGTTTTTATGGGCTGG - Intergenic
927577268 2:24210048-24210070 AAATTTCACTTTTTAAATCCCGG + Intronic
928057696 2:28074506-28074528 GAATTTTGCTTTGTAAGTCCTGG - Intronic
928132862 2:28665849-28665871 GCATTTGGGTTTTTAAGTTCTGG + Intergenic
928798192 2:35051977-35051999 GAATGGTACTTTTAAAGTGCTGG - Intergenic
928854238 2:35785057-35785079 GAAATTCATTATTTAAGTGCAGG - Intergenic
928898031 2:36287137-36287159 GAACTTTGCTTTTTGAGTGCTGG - Intergenic
930597515 2:53406319-53406341 GGGTATGACTTTTTAAGTTCTGG - Intergenic
931302883 2:60998386-60998408 GAAATTGTCTTTTTAAATTCTGG - Intronic
931831732 2:66059417-66059439 GAATGTAACTGTTTAAGGGCAGG + Intergenic
935463510 2:103367090-103367112 GAAATTGTCTTTCTAATTGCAGG + Intergenic
935631980 2:105219631-105219653 CTATTCTACTTTTTAAGTGCTGG + Intergenic
936028069 2:109048783-109048805 GAAGTTGACATTTTTAGAGCAGG + Intergenic
936269738 2:111040692-111040714 GACTTTGCCTTTTGAAGGGCAGG + Intronic
937178566 2:119967820-119967842 ATATTTGTCTTTTTTAGTGCTGG + Exonic
938719092 2:134049371-134049393 AAATTTTACTTGTTAATTGCTGG - Intergenic
939132203 2:138249706-138249728 GAAGTTGGCTTTTAAAGTGAGGG - Intergenic
939931359 2:148237805-148237827 GAATTTGAGTTCTTAAATGTAGG - Intronic
940134371 2:150419465-150419487 TAATTTTACTTTCTAAATGCAGG + Intergenic
941097081 2:161250585-161250607 GAATTTGGTTTTTCAAGTGATGG + Intergenic
941669790 2:168280933-168280955 GAATTTGTCTTTTTAAGTTCTGG + Intergenic
942561862 2:177228204-177228226 GAATTTCACTGTTAAAGTTCAGG - Intronic
944855464 2:203762877-203762899 GAATGTGACTGTCTAATTGCTGG - Intergenic
945720211 2:213409850-213409872 GAAATTGACCTTTTAAGTGTGGG - Intronic
946991461 2:225334879-225334901 GCCTTTGACATTTTAATTGCAGG + Intergenic
948260344 2:236599840-236599862 TAATTTTTATTTTTAAGTGCCGG + Intergenic
1169898710 20:10532048-10532070 GAATTTGCCTTTTTCACTGTGGG + Intronic
1170341572 20:15333840-15333862 GAACTTTACTTTTTGATTGCTGG + Intronic
1170868128 20:20178505-20178527 AAATTTGACATTTTAAATGTGGG + Intronic
1175167712 20:57056997-57057019 GAATATAACTTTTTATGCGCTGG - Intergenic
1176802102 21:13440741-13440763 AAATTTTACTTTTTAACTCCTGG - Intergenic
1177807842 21:25891944-25891966 GAATTTCATTTCTTAAATGCAGG + Intronic
1181755986 22:25025266-25025288 AAATGTCACTTTTTAAATGCAGG - Intronic
1182404157 22:30109881-30109903 GAATATAACTTTTTAAGGGTAGG + Intronic
1182684580 22:32111818-32111840 TAGTTTGATTTTTTGAGTGCAGG + Exonic
1182881410 22:33737086-33737108 GAATCTGACTGTTTACGTGGGGG - Intronic
1183122196 22:35738645-35738667 GGATTTGACTTTTTAAGCGGGGG - Intergenic
950629052 3:14269156-14269178 AATTTTGACTTTTTTACTGCAGG - Intergenic
950903611 3:16517907-16517929 GAATTTGACTTTTTTTCTGGTGG - Intergenic
951271672 3:20632460-20632482 GAATTTGACCTTTCAGGAGCAGG + Intergenic
952082573 3:29778221-29778243 GAATTTCATTTTTTAATTTCAGG + Intronic
952172032 3:30817469-30817491 CAATTGAACTTTTTAAGTGCAGG + Intronic
952426276 3:33177694-33177716 AAATTTCACTATTTAATTGCTGG + Intronic
954831331 3:53423772-53423794 GAAATGAAATTTTTAAGTGCAGG - Intergenic
958655572 3:96998117-96998139 AAATTTGACTTTTTAAATTAAGG - Intronic
958821230 3:98976058-98976080 GAATTTTTTTTTTTAAGTTCTGG - Intergenic
958985132 3:100771406-100771428 GAATTTTACCTTTTAGGTGCTGG - Intronic
959011616 3:101083926-101083948 GAATTTAACTTTGTACGTGTTGG + Intergenic
960033601 3:113080326-113080348 GATTTTGACTTTTTAGTTTCAGG + Intergenic
960343902 3:116508717-116508739 GAATTTGATTTATTGAGTTCTGG + Intronic
961228535 3:125277979-125278001 GAATATGAATTTTTAAATCCTGG - Intronic
963479210 3:145848591-145848613 GAATTCGACTTTTTAAGATGAGG - Intergenic
963868844 3:150391840-150391862 TAATTTGATTTTTCAAGTGTAGG + Intergenic
963923729 3:150929742-150929764 TAATTTGACATTGTAAGTGGAGG - Intronic
963931354 3:151007234-151007256 GCATTTGAGTTTTTAATTCCTGG - Intergenic
965439543 3:168696175-168696197 GAATTTTACTTGTTAAACGCTGG - Intergenic
966329855 3:178798871-178798893 TAATTTTAATTTTTAAGTTCTGG - Intronic
968154862 3:196371842-196371864 GAATTTTACTTTTGTAGTGTGGG - Intronic
969983128 4:11179445-11179467 GAAGTTAACTTTTTAAGATCAGG + Intergenic
970633230 4:17978210-17978232 GAATTTTACATTGTGAGTGCTGG + Intronic
971633495 4:29026670-29026692 GCATTTGACTTTTTAGGTAGAGG + Intergenic
973590084 4:52432477-52432499 TATTTTCACTTTTTCAGTGCAGG + Intergenic
974514449 4:62890817-62890839 GAATTTTTTTTTTTAAGTTCTGG - Intergenic
977531200 4:98202188-98202210 GAATATTACTTTTTAAATGTTGG + Intergenic
977803758 4:101271625-101271647 GAATTTGTCTCTTTAAGGGAGGG + Intronic
977981892 4:103333348-103333370 GAATTTTACCTTTTGGGTGCTGG - Intergenic
978154140 4:105471039-105471061 GAATTTGCCTATTTAAGTTCTGG - Intronic
980279037 4:130693983-130694005 AAATTTTACTTTTGAATTGCGGG - Intergenic
980958322 4:139450738-139450760 TAATTTTACTCTTTAAGTTCAGG - Intergenic
981297316 4:143146998-143147020 GAATTGGACATGGTAAGTGCAGG - Intergenic
982946906 4:161636418-161636440 GATTTTGACTTTTTGAATTCTGG + Intronic
983019438 4:162656609-162656631 AAATTTTTCTTTTTAAGTTCTGG - Intergenic
983849835 4:172567584-172567606 GCCTTAGACTTTTAAAGTGCTGG - Intronic
984783508 4:183547210-183547232 GAATCTAACTTTTTGAGTTCAGG + Intergenic
984833982 4:184002009-184002031 GCATTTGACGCTTTCAGTGCTGG + Intronic
984868224 4:184301496-184301518 GAATTTTTCTTTTTAGGTCCTGG - Intergenic
984935688 4:184887887-184887909 GCTTCTGACTTTTTTAGTGCTGG + Intergenic
990503475 5:56421493-56421515 GAATTTTACTTGTTAAATTCTGG - Intergenic
990582227 5:57175365-57175387 GAGGTTGACTTTTTAAGTTGGGG + Intronic
990867268 5:60393613-60393635 GAATTTGAATTTTTTGTTGCTGG - Intronic
992245772 5:74820803-74820825 GAATTTGAATTTTTTTCTGCAGG - Intronic
992533644 5:77675966-77675988 AAATTTCACTTTTTCATTGCTGG - Intergenic
992925181 5:81576247-81576269 GTATTTGAATTTTTAAGTTTTGG - Intronic
993485075 5:88474014-88474036 AAATGTGACTTTTCAAGGGCTGG - Intergenic
993707680 5:91189995-91190017 GTTGTTAACTTTTTAAGTGCTGG - Intergenic
993957699 5:94256079-94256101 GAATTTGATTTTGTTAGTGAAGG + Intronic
995807369 5:116068558-116068580 GTATTTAACTTTTTAAGATCAGG + Intergenic
997476173 5:134143775-134143797 GAATTTGACTTGTGAGATGCAGG - Intronic
998717336 5:144899998-144900020 GAATTTGAATTTTTTAGGTCAGG - Intergenic
998789434 5:145750075-145750097 TAATTTAATTTTTTAAGTTCTGG - Intronic
1001094460 5:168765625-168765647 GAAATTGACTTTTAAAGCTCTGG - Intronic
1004792846 6:19047182-19047204 GAATTTCACTTGTTCATTGCTGG + Intergenic
1011252945 6:85392359-85392381 GAATTTTACTTTCTGAGTTCTGG - Intergenic
1011261530 6:85475253-85475275 TTATTTGAGTTTTTAAATGCTGG + Intronic
1011903751 6:92334576-92334598 TAGTTTGATTTTTTGAGTGCAGG - Intergenic
1013015628 6:106158474-106158496 GTATTAGACTCTTTACGTGCTGG + Intergenic
1014161383 6:118172799-118172821 GTATGTGACTTTTTTAGGGCTGG + Intronic
1014231674 6:118910231-118910253 GTATTTTACTTTGAAAGTGCTGG + Intronic
1014701151 6:124690237-124690259 AAATTTTACTTGTTAATTGCTGG + Intronic
1014783424 6:125590595-125590617 GGATTTGACATTTTCAGTGATGG - Intergenic
1014900988 6:126965198-126965220 GAATTTGAATTTTAAATTGCTGG - Intergenic
1016179786 6:141130888-141130910 GGATTTGACATTTTCAGTGATGG + Intergenic
1017467657 6:154709627-154709649 GGATTTGACATTTTCAGTGATGG + Intergenic
1018647846 6:165964638-165964660 GAATCAGACTTTATAAGTCCTGG + Intronic
1018679001 6:166247781-166247803 CAATTAGAATTTTTAAATGCCGG + Intergenic
1020880046 7:13749919-13749941 GAAATTATCGTTTTAAGTGCTGG - Intergenic
1021400712 7:20206975-20206997 TAATTTGACTTCTTTTGTGCAGG + Intronic
1022306144 7:29148186-29148208 GAATTTGCCTTCTAAAGTGTGGG + Intronic
1022868012 7:34442993-34443015 GAATTTTTTTTTTTAAGTTCTGG - Intergenic
1024785890 7:52907185-52907207 AAATTTAACTTTTTATGTGTTGG + Intergenic
1025270893 7:57514885-57514907 GATTTTGACTTTATAAATGTGGG + Intergenic
1025725647 7:64056461-64056483 AAAGTTGACTTTTTAATTGTTGG - Intronic
1026499984 7:70935832-70935854 GTAATTGATTTTTTCAGTGCGGG - Intergenic
1026567135 7:71498580-71498602 GAATCTGACATTTTAAATCCTGG - Intronic
1026604743 7:71806194-71806216 TAATTTTACTTTTTAAGTTTTGG - Intronic
1027689689 7:81328274-81328296 AAATTATACTTTTAAAGTGCTGG + Intergenic
1028216229 7:88136960-88136982 GTATTTTACTTTTTAAAAGCTGG - Intronic
1028757012 7:94448613-94448635 GAATTTGAATTTTTAACATCTGG + Intergenic
1028903503 7:96127262-96127284 GAATTTGATTTCTTAATTTCAGG + Intronic
1031056849 7:117001236-117001258 TAATTTGTCTTTTAAAGTGGAGG - Intronic
1031588281 7:123558774-123558796 GAATTTTACTTTTTAAGGAATGG + Intergenic
1032869057 7:135961370-135961392 GATTTTGACTTTTTAATTTTGGG - Intronic
1033329879 7:140409053-140409075 AAATTTGACCTTTTAAGGCCAGG - Intronic
1034532654 7:151706381-151706403 GAATTTGACTTGTTAAAGGCAGG - Intronic
1037063097 8:14541143-14541165 TAATTTTATTTTTTAAGTTCCGG + Intronic
1039640121 8:39210246-39210268 GAATTTGTCTTTTTAGGAGAGGG - Intronic
1040627889 8:49172924-49172946 GAATTTTACTTGCTGAGTGCTGG + Intergenic
1041542644 8:59003621-59003643 AAATTTGACTTTTTAAAAGATGG + Intronic
1041695675 8:60733553-60733575 GTATTTGAATTTTGAATTGCAGG + Intronic
1042107155 8:65340340-65340362 GAACATAACTTTTTAAGTGTAGG + Intergenic
1042945377 8:74148907-74148929 GAATTTTCTTTTTTATGTGCAGG + Intergenic
1043298504 8:78697416-78697438 GAATTTGACTTTTTAAGTGCGGG - Exonic
1043805120 8:84662832-84662854 GATTTTGAACTTTTAAGTTCAGG + Intronic
1044533699 8:93336813-93336835 AAATTTGACTTTTACAGTGAAGG + Intergenic
1046174759 8:110560799-110560821 GCCTTTGTCTTTTTAAGTGAGGG + Intergenic
1046349671 8:112990951-112990973 AAATTTTACTTTTTAATTTCAGG - Intronic
1048129678 8:131680880-131680902 AAATTAGACTTTTTCAGTGTAGG - Intergenic
1048197341 8:132342728-132342750 GCATTTGAGTCTGTAAGTGCTGG + Intronic
1048313258 8:133342576-133342598 GAATTTGACGCTATAAGTCCCGG - Intergenic
1048819474 8:138367378-138367400 GAATTTGGCATTTCACGTGCAGG - Intronic
1048994105 8:139779873-139779895 AAATTTGACTTGTTCATTGCTGG - Intronic
1050219017 9:3364785-3364807 TAATTTCACTTTTTAAGAGAAGG + Intronic
1053655193 9:40211812-40211834 AAATTTTACTTTTTAACTACTGG + Intergenic
1053793613 9:41704939-41704961 GAATTTGACTTTTGTAGCCCAGG + Intergenic
1053905577 9:42841048-42841070 AAATTTTACTTTTTAACTACTGG + Intergenic
1054151562 9:61609891-61609913 GAATTTGACTTTTGTAGCCCAGG - Intergenic
1054182023 9:61916953-61916975 GAATTTGACTTTTGTAGCCCAGG + Intergenic
1054367309 9:64358028-64358050 AAATTTTACTTTTTAACTACTGG + Intergenic
1054471336 9:65541030-65541052 GAATTTGACTTTTGTAGCCCAGG - Intergenic
1054529406 9:66164502-66164524 AAATTTTACTTTTTAACTACTGG - Intergenic
1054674939 9:67847765-67847787 AAATTTTACTTTTTAACTACTGG + Intergenic
1055470410 9:76604986-76605008 TAATTTTTTTTTTTAAGTGCTGG - Intergenic
1055533930 9:77216834-77216856 GAATTTGAATGTTTGAGGGCAGG + Intronic
1056858790 9:90160535-90160557 GAGTTTGTCTTTTTAAATGATGG - Intergenic
1058087799 9:100768294-100768316 GAATTTTACTTTTTGGATGCTGG + Intergenic
1058888826 9:109343583-109343605 GAATCTTGCATTTTAAGTGCAGG - Intergenic
1059136993 9:111816603-111816625 GAATTTGACTTTTGGAGGCCAGG - Intergenic
1061504648 9:131025029-131025051 GAAATTGCCTTTTTAAATTCAGG + Intronic
1061599704 9:131659752-131659774 GCTTTTGCCTTTTTAAGTGTTGG - Intronic
1187090080 X:16087198-16087220 GACTATGACTTTTGAAGGGCAGG + Intergenic
1188198804 X:27274478-27274500 GGAATTGACTTTTTAAATGCTGG + Intergenic
1188221274 X:27544477-27544499 AAGTTTGAATTTTTAAGTGTTGG + Intergenic
1188937635 X:36196071-36196093 AAAATTGAACTTTTAAGTGCAGG + Intergenic
1189742368 X:44133109-44133131 AATTTTACCTTTTTAAGTGCTGG + Intergenic
1189941970 X:46133848-46133870 GAATGAGCTTTTTTAAGTGCAGG + Intergenic
1190371715 X:49748985-49749007 GAACTTGACTTTTGAATTGCTGG + Intergenic
1192445097 X:71205202-71205224 TAATTTTCATTTTTAAGTGCAGG + Intergenic
1193049038 X:77082033-77082055 GAAATTGGATTTTTAAATGCTGG + Intergenic
1193562978 X:83042549-83042571 GTCTTTCACTTTTTAAGTGACGG - Intergenic
1193658530 X:84227319-84227341 GGATTTGACATTTTCAGTGACGG - Intergenic
1193824797 X:86210683-86210705 GAATTTGACTTCTTCAGTGAAGG - Intronic
1196013496 X:110913432-110913454 GAAATTGACTTTGTAAGAGCTGG + Intergenic
1196407327 X:115378113-115378135 GTATTTGGCTTTTTAACTGATGG - Intergenic
1197749824 X:129956950-129956972 GGATTTTTTTTTTTAAGTGCAGG - Intergenic
1198011217 X:132556643-132556665 TAATTTGACTTCAAAAGTGCAGG - Intergenic
1198586048 X:138123701-138123723 GGATTTGACTTTTCAATTCCAGG - Intergenic