ID: 1043298505

View in Genome Browser
Species Human (GRCh38)
Location 8:78697417-78697439
Sequence AGAATTTGACTTTTTAAGTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 412}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043298505_1043298507 -3 Left 1043298505 8:78697417-78697439 CCGCACTTAAAAAGTCAAATTCT 0: 1
1: 0
2: 3
3: 31
4: 412
Right 1043298507 8:78697437-78697459 TCTCCTGGAACTGCATCATCAGG 0: 1
1: 0
2: 0
3: 16
4: 160
1043298505_1043298510 30 Left 1043298505 8:78697417-78697439 CCGCACTTAAAAAGTCAAATTCT 0: 1
1: 0
2: 3
3: 31
4: 412
Right 1043298510 8:78697470-78697492 TTACCGCAGCCAAGTGGCGCTGG 0: 1
1: 0
2: 0
3: 2
4: 43
1043298505_1043298509 24 Left 1043298505 8:78697417-78697439 CCGCACTTAAAAAGTCAAATTCT 0: 1
1: 0
2: 3
3: 31
4: 412
Right 1043298509 8:78697464-78697486 TCACGATTACCGCAGCCAAGTGG 0: 1
1: 0
2: 0
3: 1
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043298505 Original CRISPR AGAATTTGACTTTTTAAGTG CGG (reversed) Exonic
902526883 1:17064875-17064897 TGCATTTTACTTTTTAAATGTGG + Intergenic
905246616 1:36619242-36619264 AGAATCTTATTTTTTAAATGTGG - Intergenic
905400920 1:37702645-37702667 AGAATCTGACTTTTTAATCAAGG - Intronic
905859325 1:41338271-41338293 ACAGTTTGGCTTTTTAACTGTGG + Intergenic
906273875 1:44501628-44501650 AGCCTTTGACTTTTTAAGCCAGG + Intronic
906587521 1:46992502-46992524 AGTATTTGTCTTTTTATGTCTGG + Intergenic
907767887 1:57428409-57428431 AGTATTTGTCTTTTTATGTCTGG + Intronic
907773873 1:57493385-57493407 AGTATTTGTCCTTTTAAGTCTGG + Intronic
908216029 1:61953160-61953182 AGAAATTAATTTTTTAAGTCAGG - Intronic
908458214 1:64324665-64324687 AGAATCTGACTCTTAAAGTTGGG - Intergenic
910066080 1:83152260-83152282 AGAATTCGACTTCTTTTGTGGGG - Intergenic
910147616 1:84101120-84101142 AGAAATTGACTTATTGATTGTGG + Intronic
911286580 1:96001755-96001777 AGGATTTGAATTTTCATGTGTGG + Intergenic
911484222 1:98485377-98485399 AGAATTTTACTTTTAAAGAAAGG + Intergenic
912485957 1:110028660-110028682 GGAGTTTAAGTTTTTAAGTGGGG + Intergenic
914869664 1:151462261-151462283 AGAATTTGCTATTTTATGTGGGG + Intergenic
915025926 1:152829518-152829540 AAAATTTGACTGTTTCACTGAGG - Intergenic
917686421 1:177421162-177421184 AGAATTTGACTTTATATCAGAGG - Intergenic
917692762 1:177486031-177486053 ACAATTTGAGATTTTAACTGTGG + Intergenic
917895521 1:179483707-179483729 AGAATTTAATTTTTATAGTGTGG + Intronic
918643592 1:186875405-186875427 AGAATTTAACATTATAATTGTGG - Intronic
918835729 1:189462786-189462808 AGAATTTGATTTTTTAGATGTGG + Intergenic
918840787 1:189535441-189535463 AGCATTTGACATTTTATATGGGG + Intergenic
919005743 1:191897222-191897244 AGAGCTTGACTTTTTAAGAAGGG + Intergenic
919155000 1:193753121-193753143 AGGATTTGACTGTGTAAGTCAGG + Intergenic
919565221 1:199176594-199176616 ACAATTTGTTTTTTTAAATGTGG - Intergenic
920724590 1:208422205-208422227 ATAATTTGATTTTTGAAGAGTGG - Intergenic
921778437 1:219130981-219131003 TGAATTTGACCATTTGAGTGTGG + Intergenic
921926084 1:220711013-220711035 AAAATTTGTCTATGTAAGTGTGG + Intergenic
923460989 1:234209278-234209300 GAGATTTGAGTTTTTAAGTGGGG + Intronic
924584177 1:245347240-245347262 AGAAATTTATTTTTTAAGTTGGG - Intronic
1064168188 10:13004525-13004547 AGAATGTGTCTATTTCAGTGAGG + Intronic
1065239600 10:23693138-23693160 AGAATTTGAATTTTCAAATGCGG + Intergenic
1065289008 10:24211647-24211669 GGGATTTGTCTTTTTAAATGGGG + Intronic
1067956956 10:50802088-50802110 AATATTTTACTTTTTAAGAGAGG + Exonic
1068165692 10:53329542-53329564 AGAATTTTACTTTTTGAATAAGG + Intergenic
1068247929 10:54396828-54396850 AGAATTTGACAATTCAAGTATGG + Intronic
1068378586 10:56216753-56216775 AGAACTTGACTCTGGAAGTGGGG + Intergenic
1068478340 10:57557186-57557208 ATGATGTGACTATTTAAGTGGGG + Intergenic
1068670684 10:59719721-59719743 AAAGTTTGACTTGTCAAGTGTGG + Intronic
1069963385 10:72092652-72092674 AGAATGTGACTGTTTATTTGGGG - Intergenic
1070838480 10:79466950-79466972 AAAATTTGACCTTTTAAGTATGG - Intergenic
1073499000 10:103919030-103919052 AGAATTTCTATTTTAAAGTGAGG + Intergenic
1074802997 10:117020516-117020538 ATAAGATGACTTTATAAGTGTGG - Intronic
1075801438 10:125156804-125156826 GAAATTTTACTTTTTAAGTCTGG - Intronic
1075917728 10:126183599-126183621 AGAATTTTATTTTAGAAGTGCGG - Intronic
1076006851 10:126954759-126954781 AGAATTTCCTTTTTTAGGTGTGG + Intronic
1076007937 10:126963022-126963044 ATCATTTGACTTTCTATGTGAGG + Intronic
1078292955 11:10033162-10033184 AGAATATGATTCATTAAGTGTGG - Intronic
1078344438 11:10532960-10532982 AGGATTGGACCTTTTAACTGAGG - Intronic
1078702792 11:13704520-13704542 AAATTTTGACTTTTTAATTTTGG + Intronic
1079880868 11:25924434-25924456 AAAATATGACTTTTAAAATGTGG + Intergenic
1080141641 11:28928221-28928243 AACATTTTACTTTTTAAGTTGGG - Intergenic
1080809039 11:35684338-35684360 TCAATTTTACTTTTTAATTGTGG + Intronic
1081001479 11:37678412-37678434 AGTATTTGTCTTTCTATGTGTGG - Intergenic
1081076822 11:38685650-38685672 AGAATTCCAGTTTTTAAATGTGG - Intergenic
1085578870 11:77632586-77632608 AGAATAAGTGTTTTTAAGTGTGG - Intronic
1085845990 11:80065562-80065584 AATAATTGACTTTTTCAGTGTGG - Intergenic
1085982349 11:81739714-81739736 AGAATCTGATTATTTAAGTTTGG - Intergenic
1086030636 11:82350990-82351012 AGAACTTGAGTTTTAAAGGGAGG - Intergenic
1086551797 11:88061004-88061026 ACAATTTGTTTTTTTAGGTGAGG + Intergenic
1086769217 11:90740338-90740360 GGAATTTCTCTTTTTAAGTAGGG - Intergenic
1087487492 11:98774754-98774776 GTAATTTGATTTTTTAAATGTGG - Intergenic
1088278079 11:108110021-108110043 AATATTTTACATTTTAAGTGTGG + Intergenic
1088854195 11:113732022-113732044 AGAAGTTGGCTTTCTAAGAGAGG - Intergenic
1089968500 11:122673273-122673295 AGGATTTGAATTTGTAAGTTAGG + Intronic
1090775928 11:129965938-129965960 GTAATTTGGATTTTTAAGTGAGG - Intronic
1090809935 11:130228905-130228927 AGAATTTGACTTTATAAACCAGG + Exonic
1090996200 11:131868135-131868157 AGAATTAGAATTTTAAAGTCTGG + Intronic
1091005643 11:131950763-131950785 AGAATTTCATTTTTTGAGTTGGG - Intronic
1091334495 11:134756256-134756278 AGAATTTGCCTTTTGATGTTGGG + Intergenic
1092174537 12:6394142-6394164 AGAATTTCCCTTTTTGAGAGTGG + Intergenic
1092647373 12:10590780-10590802 TGATTTTGAGTTCTTAAGTGGGG - Intergenic
1093421481 12:18979310-18979332 AAAAGATGACTTTTTAGGTGAGG - Intergenic
1095359229 12:41315983-41316005 AGCATGTGACTTATGAAGTGAGG + Intronic
1098082692 12:66806643-66806665 AGAGTTTGATTTTTTAATTTTGG + Intergenic
1098331076 12:69354343-69354365 AATATCTGACTATTTAAGTGAGG - Intergenic
1098559555 12:71856420-71856442 AGAATTTGGCTTCTTATGGGAGG + Intronic
1099203388 12:79701107-79701129 AGAATTTGGCTTTTTTAGATTGG - Intergenic
1099228999 12:80001588-80001610 AGAAGTATACTTTCTAAGTGTGG + Intergenic
1099739177 12:86609714-86609736 AAAATCTTACTTTTTAAGTAGGG - Intronic
1099916389 12:88899686-88899708 AGAATTTGACCTTTTGCGTCTGG - Intergenic
1100304029 12:93334066-93334088 AGAATTTGTCTTTTTATGACTGG + Intergenic
1100379590 12:94049207-94049229 AGAATGTGACTTGTAAACTGAGG - Intergenic
1100682589 12:96944154-96944176 AGAATTTAATTTTTTATGTAAGG + Intronic
1101255669 12:102974269-102974291 AGAGTTTTACTTTTTAAGCCAGG + Intergenic
1101418042 12:104526047-104526069 AGAATTGGATTTTCTAAGTGGGG - Intronic
1101869858 12:108556990-108557012 AGAAGCTGACTTTTAAGGTGTGG + Intronic
1104183665 12:126407407-126407429 AGTATTTGACCTTTTGAGTTTGG - Intergenic
1104886910 12:132115870-132115892 AGAATATTAATTTTTTAGTGTGG - Intronic
1105519720 13:21121292-21121314 AGATGTTGCATTTTTAAGTGGGG - Intergenic
1105556674 13:21453742-21453764 ATAATTTGAATTTTGAAGGGTGG + Intronic
1105916188 13:24918975-24918997 AGAATCTGACCTTTTAACTTTGG + Intronic
1106863043 13:33931837-33931859 AGAATTTGACTTTATAATGAAGG - Intronic
1106887566 13:34206394-34206416 AGACTTCACCTTTTTAAGTGAGG - Intergenic
1106894655 13:34286446-34286468 AAAATTTGACTTTGTAACTCTGG - Intergenic
1106975505 13:35207922-35207944 AGAATTTGGCATTTAAAGTCTGG + Intronic
1107687185 13:42914245-42914267 AGAAGTTTACATTTTAAGGGAGG - Intronic
1108868085 13:54946353-54946375 AGAAATAGATTGTTTAAGTGAGG + Intergenic
1109797448 13:67335288-67335310 AGAATTTCAGTTTTTAATTCAGG + Intergenic
1110313647 13:74080111-74080133 AGTATTTGACTTTTTGTGAGTGG - Intronic
1110763903 13:79260864-79260886 ATAATTTTAATTTTTAAATGGGG + Intergenic
1111331044 13:86762260-86762282 AGAATTTCACTTTTTGAGGAAGG + Intergenic
1111357914 13:87134198-87134220 AAAATTTGTTTTTTTAATTGTGG - Intergenic
1111617986 13:90685693-90685715 AGAACTTGCCTTTTAAAGTGGGG - Intergenic
1112032086 13:95466404-95466426 AGGCTTTGACTGTTAAAGTGAGG + Intronic
1112536314 13:100259999-100260021 TGACTTTGACTTTTTACTTGTGG + Intronic
1113542150 13:111116663-111116685 AGGATTTCAGTTTTTAAGTGGGG + Intronic
1114347383 14:21810313-21810335 ACATTTTGATTTTGTAAGTGAGG + Intergenic
1114934858 14:27521719-27521741 AGAATTTGAATTACTAAATGGGG - Intergenic
1116084836 14:40221700-40221722 AGAATTTGATTTTGTCAGTAGGG - Intergenic
1116450230 14:45056327-45056349 ATAATTTGACTTTTGCAGTTGGG + Intronic
1116844717 14:49854527-49854549 AGTATTTGTCTTTTTATGTCTGG - Intergenic
1117924335 14:60761456-60761478 AGAAAGTGACTTTTAAAGTTTGG + Intronic
1118272518 14:64356610-64356632 ATCATTTGAATTTTAAAGTGAGG + Intergenic
1118424047 14:65638485-65638507 ACTATTTCACTTTTTAAATGAGG + Intronic
1118685866 14:68290649-68290671 AGAATTTAACTATTTAAAAGAGG + Intronic
1119409153 14:74418470-74418492 ATGATTTTATTTTTTAAGTGAGG - Intronic
1119624220 14:76157560-76157582 AGAATTTTACTTTTTAGCAGTGG + Intronic
1120268407 14:82279485-82279507 AGAAATTGACCTTTACAGTGAGG + Intergenic
1120636311 14:86955602-86955624 AGAATATGACTTTTTCACTAAGG - Intergenic
1124048156 15:26170166-26170188 AAAATTTAAATTTTTAAATGAGG - Intergenic
1124604102 15:31158117-31158139 ATAATTTTACTTCTTAAGTGAGG + Intronic
1127350708 15:58149274-58149296 AGACTTTCAGTTTTTAACTGGGG + Intronic
1127366792 15:58298956-58298978 AGATCTTGACGTTTTCAGTGAGG - Intronic
1127694141 15:61427831-61427853 AAAATTTGACTGTATAAATGTGG - Intergenic
1128034566 15:64513046-64513068 AAAATTTAAAATTTTAAGTGTGG + Intronic
1128413750 15:67424338-67424360 AGAATTTGACTTTGTCAGGAAGG - Intronic
1128588921 15:68877050-68877072 AGGACTTGCCTTTTGAAGTGAGG + Intronic
1128763179 15:70233072-70233094 TCAATATGACTTTTTAAATGAGG - Intergenic
1129528299 15:76238304-76238326 AAAACTTGATTTTTTAAGAGAGG - Intronic
1129809584 15:78497779-78497801 AGATTTTGACTTATTAATTGGGG - Intronic
1130201684 15:81835280-81835302 AGACTTTACCTTTTTAACTGAGG - Intergenic
1134158319 16:11862778-11862800 AGAATGTGACATTTTAAGGAAGG + Intergenic
1134415665 16:14041433-14041455 AGTATTTGTCTTTTTATGTCTGG + Intergenic
1134912524 16:18040696-18040718 AAAATTAGACTTTGAAAGTGGGG + Intergenic
1135299601 16:21314149-21314171 AGGACTTGACTTTATAAGTAAGG - Intergenic
1136959145 16:34825759-34825781 AGTATTTTACTTTTTTATTGTGG - Intergenic
1138055416 16:53828173-53828195 AGAATTTGAATCTGTAAGAGCGG + Intronic
1138945125 16:61840288-61840310 ATAATTTGACATTTGAAGAGAGG - Intronic
1139397602 16:66652891-66652913 AAAATTTGACTTTTTGAGCAGGG - Intronic
1139563562 16:67758836-67758858 AGAATAAGACTTTTTAGGTCTGG + Intronic
1140879901 16:79188566-79188588 AGAGTTTGACTTCGTAAGTGTGG - Intronic
1143587811 17:7859528-7859550 AGAATTTGACTATCTCAGTATGG + Exonic
1143694233 17:8599348-8599370 AGAATTTGACATATTAAGTAGGG - Intronic
1144086586 17:11814650-11814672 AGAATATGACTTTAGAAGAGAGG - Intronic
1144245489 17:13359424-13359446 AGAATATGACTTATATAGTGTGG - Intergenic
1144288819 17:13805990-13806012 AGAAATTGGCTTTTCAAGTAGGG - Intergenic
1144888897 17:18482607-18482629 AGATGTTGACTTTTTAGATGAGG + Intronic
1145143310 17:20461688-20461710 AGATGTTGACTTTTTAGATGAGG - Intronic
1145169864 17:20646550-20646572 AAAATTTAACTTGTTAAGTCTGG + Intergenic
1145368078 17:22281158-22281180 AGAATTTGATTTTTTAGATCTGG + Intergenic
1146530848 17:33606733-33606755 AGGATTTGAATGTTTCAGTGTGG - Intronic
1148395292 17:47303344-47303366 AGAAAGTGACTTGTTAATTGAGG + Intronic
1148956497 17:51358191-51358213 ATAAATTGATTTTTTAAATGTGG - Intergenic
1149233210 17:54560391-54560413 AGCATTTGTCTTTTTATGTCTGG - Intergenic
1149308894 17:55375063-55375085 AGAAGTGGAGATTTTAAGTGAGG + Intergenic
1149729835 17:58934213-58934235 ACAATTTGACTTTTTAAAGGAGG + Intronic
1150508357 17:65722182-65722204 AGATTTTCATTTTTGAAGTGGGG + Intronic
1151014444 17:70537837-70537859 GGAATTTGCCTTTTAAATTGAGG - Intergenic
1151046487 17:70925911-70925933 AGCATTTGACATTTGAACTGTGG - Intergenic
1151446571 17:74169770-74169792 AGAATTGGACTTTTTAGGCTGGG + Intergenic
1153236493 18:2993431-2993453 AGAAATTCACTTTTTGGGTGAGG - Intronic
1156381044 18:36561543-36561565 TGATTTTGACTTTTTTATTGTGG + Intronic
1156643427 18:39129942-39129964 AGAATTTTAGTTATTAAATGTGG - Intergenic
1156803001 18:41141189-41141211 AGGATTGGACTTTTTAAAGGGGG - Intergenic
1156888589 18:42164520-42164542 AGAATTTGGCTTTTTAAACCTGG - Intergenic
1157280684 18:46344714-46344736 AGAATCTGACTTTTCAGGTCTGG - Intronic
1158032557 18:52983776-52983798 AGAAATTTACATTTTAATTGAGG + Intronic
1159190257 18:65032066-65032088 ATAATTTGACTATGTATGTGAGG + Intergenic
1159320717 18:66844556-66844578 AGTTTTTGGCTTTTTAATTGTGG - Intergenic
1159719353 18:71867284-71867306 TGAATTTGACAATTTTAGTGAGG - Intergenic
1163715950 19:18872273-18872295 AGTATTTGCCTTTTGAGGTGTGG + Intronic
1164831474 19:31324714-31324736 ATACTTTGCCTTTCTAAGTGGGG - Intronic
1164968357 19:32507852-32507874 AGAATTTGATTTTGTTAGTCTGG + Intergenic
1168086652 19:54052522-54052544 AGAATTTGTCTTTCTGAGTCTGG + Intronic
1168445939 19:56413882-56413904 ACAATTTAACTTTTTAACTTAGG + Intronic
925509734 2:4611878-4611900 AAAATGTGACTTTTTCACTGTGG + Intergenic
926032607 2:9605484-9605506 AGAATTGGACATATCAAGTGAGG - Intronic
926494904 2:13574356-13574378 CGAATTTGACTTATTGAGTGTGG - Intergenic
927102153 2:19796143-19796165 AGAAATCGACTTTTCATGTGTGG - Intergenic
927285103 2:21349183-21349205 AGAATTGGCTTTTTTAATTGTGG + Intergenic
927286765 2:21364916-21364938 AGAATGTAACTTTTTCACTGAGG + Intergenic
927823821 2:26293287-26293309 AGCATTTGACTATGTATGTGAGG - Intergenic
928994294 2:37270633-37270655 AGGCTTTGTCTTTATAAGTGTGG - Intronic
930037564 2:47096667-47096689 TGGATTTGACTTTTTAAGCTTGG - Intronic
931023449 2:58078245-58078267 AGTATTTGTCTTTTTGTGTGTGG + Intronic
932629156 2:73323426-73323448 AGTATTTGCATGTTTAAGTGGGG - Intergenic
933132644 2:78691531-78691553 TGAATTTGAATTTTAAAGAGGGG + Intergenic
935666484 2:105517263-105517285 AGAAACTTACTTTTTAAATGAGG + Intergenic
936441523 2:112558173-112558195 AGAAATTTACTTTTTTCGTGGGG - Intronic
938782939 2:134601887-134601909 ACAATCTCACCTTTTAAGTGAGG - Intronic
938811568 2:134858273-134858295 AGTATTTGTCTTTTTATGTCTGG - Intronic
938817309 2:134918034-134918056 AGAAATTGAATTTCTAAATGAGG - Intergenic
938842778 2:135179058-135179080 AGAAATTGATTTTTTGAGTAGGG - Intronic
938885650 2:135645162-135645184 AACATTTGAATATTTAAGTGAGG + Intronic
939132204 2:138249707-138249729 AGAAGTTGGCTTTTAAAGTGAGG - Intergenic
939257769 2:139766541-139766563 AGCCTTTGAACTTTTAAGTGAGG + Intergenic
939316994 2:140564682-140564704 AAAATTTTACTTTTTAATTGAGG - Intronic
939758369 2:146141919-146141941 AGAATTTCACCTTGTCAGTGGGG - Intergenic
940349632 2:152667788-152667810 AGAATTTGAATTAGTAAGTCTGG - Intronic
940409063 2:153338954-153338976 AGAATTTCATTTTTTAAGGCTGG + Intergenic
940631118 2:156240591-156240613 AGAATTTGACTTCCATAGTGTGG + Intergenic
940800609 2:158128769-158128791 AGATTTTTCCATTTTAAGTGTGG + Intronic
940804550 2:158171713-158171735 AGAATTTGACTTTTTAATTATGG - Exonic
941643247 2:168011761-168011783 AGAATTTCACTTTGAAACTGTGG - Intronic
942367999 2:175249533-175249555 ATAAATTGACTTTTTAACTATGG + Intergenic
943079628 2:183242662-183242684 AAAATTTGTCTTTTTAAATTTGG + Intergenic
943640129 2:190348637-190348659 AGTATTTGTCTTTTTCAGTCTGG + Intronic
943719756 2:191191405-191191427 AGAATTTTATTTTCTATGTGTGG + Intergenic
943765880 2:191661882-191661904 AGCATCAGACTTTTTAAGTTGGG + Intergenic
944887766 2:204082407-204082429 AAAATGTGACTTTTTTAGTTGGG + Intergenic
945487242 2:210411103-210411125 AAAATTTGACTTTTTATATGTGG + Intergenic
945507682 2:210661629-210661651 GGAATGTGACTTTTTATGTTGGG + Intronic
945546684 2:211162758-211162780 AGAATTTTACTTTTAACTTGTGG + Intergenic
945596388 2:211800053-211800075 AGAACTTTCCTTTTTAAGGGTGG + Intronic
945720212 2:213409851-213409873 AGAAATTGACCTTTTAAGTGTGG - Intronic
946101517 2:217328945-217328967 ACAATTTCACTATTTAAATGTGG - Intronic
946591160 2:221249134-221249156 AGATTTCTACTTTATAAGTGAGG + Intergenic
947265974 2:228281937-228281959 AGTATTTGTCTTTTTATGAGTGG - Intergenic
948779100 2:240306243-240306265 AGAATTTGGATTTTTAGGCGGGG - Intergenic
1168885931 20:1255600-1255622 AAAATTTGACTTCTTAATTTTGG + Intronic
1169482348 20:5995952-5995974 ACAATGTAAATTTTTAAGTGAGG + Intergenic
1169898709 20:10532047-10532069 GGAATTTGCCTTTTTCACTGTGG + Intronic
1169971887 20:11277574-11277596 GGAATTTGAATTTCTAACTGAGG - Intergenic
1170674769 20:18468487-18468509 AGATTTTGACTTTTTTTGTTTGG + Intronic
1170868127 20:20178504-20178526 GAAATTTGACATTTTAAATGTGG + Intronic
1171741953 20:28906233-28906255 AGAAACTTATTTTTTAAGTGTGG + Intergenic
1172029500 20:31971752-31971774 AGCATTTGAATTTTTAATTCAGG - Intronic
1172063599 20:32204155-32204177 AGAATTTGACTTTGAAGGTAGGG - Intronic
1172534021 20:35656800-35656822 AAAAGTTGACTTTTCAGGTGGGG - Intronic
1172713232 20:36943463-36943485 AGAATTTGAGTTATGAGGTGGGG + Intronic
1174623872 20:51898331-51898353 AGTATTTGAATTTTTAAATAAGG + Intergenic
1176989960 21:15483549-15483571 AGCATCTGACTTTTTAACTTGGG + Intergenic
1177628317 21:23694005-23694027 AGAATTTGTATTTTGCAGTGTGG - Intergenic
1179931145 21:44571864-44571886 AGAATTTCAATTAGTAAGTGTGG + Intronic
1180864591 22:19109513-19109535 AGTATTTGTCTTTTTATGTTTGG - Intronic
1180883480 22:19223280-19223302 ACATTTTGAAGTTTTAAGTGTGG + Intronic
1181664703 22:24385172-24385194 ATTTTTTGACTTTTTCAGTGTGG + Intronic
1182881411 22:33737087-33737109 TGAATCTGACTGTTTACGTGGGG - Intronic
1183122197 22:35738646-35738668 TGGATTTGACTTTTTAAGCGGGG - Intergenic
1183239431 22:36645869-36645891 TGCATTTGACTTTTAAAGTTTGG - Intronic
949509595 3:4756680-4756702 AGAATTTTTTTTTTTAAGTTTGG - Intronic
950692857 3:14674212-14674234 ATAATTTCACTTTTTAAATATGG - Intergenic
950970364 3:17180664-17180686 AGAATTTGACTATTTCTGAGTGG - Intronic
953372552 3:42401657-42401679 ATAGTTTGAATTTTTAAGTCAGG + Intronic
955071062 3:55572741-55572763 AGAATTTGACTATTGGAGGGAGG - Intronic
957235281 3:77580659-77580681 AGAATGTGATTTTTTAAATCTGG + Intronic
957463196 3:80550036-80550058 AAAATTTGTCATTTTCAGTGCGG + Intergenic
957722434 3:84020821-84020843 AACATTTGACTTTTACAGTGTGG + Intergenic
957929046 3:86853901-86853923 AGAACTTTATTTTTTAACTGTGG + Intergenic
958780552 3:98536570-98536592 TGATTTTGACTTGTTAAGAGTGG - Intronic
959270720 3:104206556-104206578 AGAATTCTAGTTTTTAAATGTGG - Intergenic
959374786 3:105575395-105575417 AGAATTGGAGTTTTTAACAGTGG + Exonic
959574804 3:107923341-107923363 GGACTTTGACTTATTAAGAGTGG - Intergenic
959758085 3:109923792-109923814 CGTATTTGACTTTGTAAGGGAGG + Intergenic
960308197 3:116088187-116088209 AGAATTTGACTTAATAAGTTGGG + Intronic
961683593 3:128615066-128615088 TGAATTTGCCTTCTTATGTGTGG - Intergenic
962519473 3:136184930-136184952 AAAATTTGGATTTTTATGTGAGG + Intronic
962535550 3:136326149-136326171 AAATTTTTACTTTTTAAGTAAGG - Intronic
962785691 3:138766561-138766583 AAAATTTTTCTTTGTAAGTGAGG - Intronic
963342134 3:144049075-144049097 CGTATTTGACTTTTTCACTGTGG - Intergenic
963487708 3:145957059-145957081 AAAATTTGACTTCTGAAATGAGG - Intergenic
963555840 3:146787137-146787159 AGAATTTGACTTATGAATAGAGG - Intergenic
964993102 3:162839801-162839823 AGAGTTTGACTTTGGAAATGGGG - Intergenic
965504917 3:169504570-169504592 GGAATTTGAGTTTTTGAGTGTGG - Intronic
966040899 3:175486639-175486661 AGAATGAAACTTTTTAAATGTGG + Intronic
967536088 3:190604886-190604908 ATTATTTTACTTTTTGAGTGTGG + Intronic
967563176 3:190941816-190941838 ATCATTTGACTTTCTAATTGAGG + Intergenic
967576650 3:191102776-191102798 AGAATTTGACCTTCTAAGCTGGG + Intergenic
968154863 3:196371843-196371865 AGAATTTTACTTTTGTAGTGTGG - Intronic
968256321 3:197276483-197276505 GTAATTTGCATTTTTAAGTGTGG + Intronic
969193248 4:5541123-5541145 AGAATACGACTTTTTAAGGGAGG + Intergenic
971139799 4:23912066-23912088 AGAAATGAATTTTTTAAGTGGGG + Intergenic
973242796 4:47975304-47975326 ACAATTTGACTTACCAAGTGTGG - Intronic
973868411 4:55138783-55138805 AGAATTTGACTTTTGATTTTAGG - Intergenic
974019119 4:56677399-56677421 ACCATTTGAATTTTTAAGTGGGG - Intronic
974218793 4:58937882-58937904 AGGATTTGACTTTTGAAATCTGG - Intergenic
974579984 4:63785071-63785093 ACAATTTACCTTTTTAAGGGTGG + Intergenic
975576719 4:75870364-75870386 ATAATTCTTCTTTTTAAGTGAGG + Intronic
976066672 4:81195637-81195659 TGCATTTGTCTTTTTAAGTCTGG + Intronic
976854391 4:89585789-89585811 AGCAATTGACTTTTTGTGTGTGG + Intergenic
977281541 4:95046070-95046092 ATAATTTGACTTTTTTTTTGAGG + Intronic
977324039 4:95552480-95552502 GGAATTTGACTTTTTAGGGTTGG + Intergenic
977491057 4:97711971-97711993 AGATTGTGACATTTTAAGTAAGG + Intronic
977803757 4:101271624-101271646 CGAATTTGTCTCTTTAAGGGAGG + Intronic
977890633 4:102307487-102307509 AGATTTTGACCTTTTTTGTGGGG - Exonic
978732761 4:112049417-112049439 AGTATTTGACTTTTTCATTCTGG - Intergenic
979361797 4:119773954-119773976 AGACTTTGAGTTTCTAGGTGTGG + Intergenic
979963749 4:127052296-127052318 AGAATCTGGCTTTTTAATTAGGG - Intergenic
980415357 4:132481902-132481924 AGACTTTGAATTTTCAAGTTAGG + Intergenic
981127465 4:141123087-141123109 AGCATTTGACTCATAAAGTGGGG - Intronic
981651887 4:147069656-147069678 AGTCATTGAGTTTTTAAGTGTGG + Intergenic
981840837 4:149109745-149109767 AGAACTTAACTTTTTAACTTTGG + Intergenic
982928942 4:161377147-161377169 AGAATATTATTTTTTAAGTTTGG - Intergenic
982950820 4:161693400-161693422 AGAATTTTTCTTTTAAAGTTTGG + Intronic
983736097 4:171062906-171062928 AGAAATTGATTTTCTATGTGGGG - Intergenic
983884311 4:172963253-172963275 AGAAGATGAATTTTTGAGTGAGG - Intronic
983962591 4:173772638-173772660 ATTTTTTGACTTTTTAATTGTGG + Intergenic
985031034 4:185790353-185790375 ACAATATGTCTTTTTGAGTGTGG - Intronic
985134904 4:186776678-186776700 AGAATGTTACTTTTTAATAGTGG + Intergenic
985349720 4:189046295-189046317 AGAAATTAACTTTTTCCGTGTGG - Intergenic
986134920 5:4967574-4967596 AGAATTTGAATTTTGAAGTGAGG + Intergenic
988037489 5:25846580-25846602 AGAATTTGTCTTTTTAGGCCTGG - Intergenic
988283397 5:29179616-29179638 ACAATTTTACTTTTTAACTCTGG - Intergenic
989019827 5:36990539-36990561 AAAATTTGAGTTTTTAAGAAAGG - Intronic
989376113 5:40763089-40763111 TGAATTTGCTTCTTTAAGTGGGG + Intronic
989439944 5:41458496-41458518 ATAATTTAACTTTTTAATTTTGG - Intronic
989467210 5:41770457-41770479 TGAATTTGCTTTTTCAAGTGGGG + Intronic
989975084 5:50575657-50575679 GGAATTTGCCTTTTTATGTTTGG - Intergenic
990312431 5:54552885-54552907 AGAATTTGTTATTTTAATTGAGG + Intergenic
990582226 5:57175364-57175386 AGAGGTTGACTTTTTAAGTTGGG + Intronic
990852429 5:60222111-60222133 GGAGTATGACTTTTGAAGTGAGG + Intronic
992470336 5:77045899-77045921 ATAATTTTACTTTTTAAATGTGG + Intronic
993092825 5:83447995-83448017 AGAATTTGACTTTTCAAGGTAGG + Intergenic
993346559 5:86790875-86790897 AGAATTTGAATTAATAAATGAGG - Intergenic
993489542 5:88529752-88529774 AGTATGTGACTTTTTAAGGTTGG + Intergenic
993521616 5:88909496-88909518 AAATGTTGACTTTTTAAGTGTGG - Intergenic
993943720 5:94093969-94093991 GGAATTTGCCTTTCTAAGTTTGG - Intronic
994582792 5:101667745-101667767 AGAATTTTACTTTTTAATACAGG + Intergenic
994674364 5:102802625-102802647 AGAGTTTGAGTAATTAAGTGGGG - Intronic
996252616 5:121355030-121355052 AGATTTTGATTTTGTATGTGTGG + Intergenic
996908277 5:128627008-128627030 AGAAAATGATTTTTTAAATGTGG + Intronic
998064904 5:139150272-139150294 AGCTTTGGACTTCTTAAGTGTGG - Intronic
998323438 5:141255467-141255489 AAAATATGAAATTTTAAGTGAGG - Intergenic
998859620 5:146429515-146429537 ATTGTTTTACTTTTTAAGTGTGG - Intergenic
998923818 5:147100623-147100645 AAATTTTGTCTTTTTAAATGAGG - Intergenic
999845197 5:155471502-155471524 ATAATTTAACTTCTTCAGTGTGG + Intergenic
1000547862 5:162624092-162624114 ATAACTAGAATTTTTAAGTGAGG + Intergenic
1004786181 6:18970084-18970106 ACAATTTGAATGTTTAAGGGAGG + Intergenic
1004968010 6:20876624-20876646 AGAATATGAATTTTGAAGTCAGG + Intronic
1005002839 6:21260073-21260095 AGATTTTCACCTTTTAACTGTGG + Intergenic
1005139140 6:22607443-22607465 AGAAATTCACTTTTTAAGTCAGG - Intergenic
1006526053 6:34606097-34606119 ATATTTTGACTTTTCAAATGTGG - Intronic
1006850902 6:37097744-37097766 ATAATTTCACTTCTTAAGAGTGG - Intergenic
1006966403 6:37990138-37990160 AGAATTTGACTCTCTAGGTCTGG + Intronic
1007389620 6:41543507-41543529 AGCATTCGTCATTTTAAGTGAGG + Intergenic
1008473159 6:51907270-51907292 ATAATTTGACTTTTACAGTTGGG + Intronic
1008683485 6:53899399-53899421 AGAATTTAGCTTTTCAAGTTCGG - Intronic
1009263747 6:61528298-61528320 AGAATTTGACTGTGTAGGAGAGG - Intergenic
1009533128 6:64845788-64845810 AGAATTTTACTTTTTGAGTCAGG - Intronic
1009710039 6:67306429-67306451 ATTATTTGACTTTTTAATTATGG + Intergenic
1011241273 6:85273745-85273767 AGTCTGTGACTTTTTAATTGTGG + Intergenic
1012946894 6:105475944-105475966 ATAAATTGATTTTTTAAATGTGG - Intergenic
1012951795 6:105526037-105526059 AGAATTGTACTTTTTAACTTAGG + Intergenic
1013003852 6:106051924-106051946 AATATTTGTCTTTTTAAATGTGG - Intergenic
1014348962 6:120314784-120314806 TAAATTTGACTTTTTAAATTTGG - Intergenic
1014905715 6:127024558-127024580 AGAATTTGACTTTTTATCTTGGG + Intergenic
1015046686 6:128784606-128784628 AGAATTTGTGTTTATAAGGGAGG - Intergenic
1016365292 6:143309382-143309404 ATGATTTTTCTTTTTAAGTGAGG + Intronic
1016658671 6:146549996-146550018 TGAGTTTGAGTTTTTAACTGAGG + Intronic
1017146037 6:151236155-151236177 TGAATTTTACTTTCTATGTGAGG - Intergenic
1017833703 6:158156426-158156448 AGGCTTTGTCTTTTTATGTGGGG - Intronic
1018030269 6:159836277-159836299 AGAATTTGACTTTTTGGTAGAGG - Intergenic
1019190849 6:170249782-170249804 AGAATTTGACCTTAAAATTGGGG + Intergenic
1020383213 7:7567952-7567974 CTAATTTTACTTTTTAAATGTGG + Intronic
1022100433 7:27166196-27166218 TGAATTTGACTTTTCGAGGGCGG - Intronic
1022306143 7:29148185-29148207 GGAATTTGCCTTCTAAAGTGTGG + Intronic
1023042863 7:36187496-36187518 GGTATTTGTCTTTTTGAGTGTGG + Intronic
1023674404 7:42615294-42615316 AGCATTTGACACTTTTAGTGTGG - Intergenic
1025173314 7:56781385-56781407 AGAATTTAATTTTTAAAATGGGG + Intergenic
1025270892 7:57514884-57514906 AGATTTTGACTTTATAAATGTGG + Intergenic
1025830497 7:65044814-65044836 AGAATTTAATTTTTAAAATGGGG - Intergenic
1025917652 7:65878599-65878621 AGAATTTAATTTTTAAAATGGGG - Intronic
1026094284 7:67330186-67330208 AAATGTTGACTTTTTAAGTGTGG + Intergenic
1026623679 7:71973831-71973853 AGACTTTGGCGTTTTAATTGAGG + Intronic
1026905004 7:74057793-74057815 AGAATGTGACAGCTTAAGTGGGG - Intronic
1027278030 7:76582516-76582538 AGAATTCGACTTCTTTTGTGGGG + Intergenic
1027412359 7:77934538-77934560 AGCAGTTGAGATTTTAAGTGAGG + Intronic
1027732176 7:81888238-81888260 TCAAATTGACTTTTTAACTGAGG - Intergenic
1028147421 7:87333666-87333688 ACAATGTGACTTTTTGAGTTTGG + Intergenic
1028422237 7:90646483-90646505 ATATTTTTATTTTTTAAGTGAGG - Intronic
1028581196 7:92411312-92411334 ACAATTTGACCTTTTAACTTGGG + Intergenic
1028932569 7:96429416-96429438 AAAAGTTGACTTTTTTTGTGAGG + Intergenic
1029194576 7:98796202-98796224 AGAAGCTGACTTTTTAATTTGGG - Intergenic
1030462612 7:109859482-109859504 TGAATTTTATTATTTAAGTGAGG - Intergenic
1030469203 7:109941556-109941578 ACAATTTCCCTTTTTAAGTAAGG - Intergenic
1031034276 7:116770672-116770694 AATATTTGTCTTTTTATGTGTGG + Intronic
1031061775 7:117059975-117059997 AGAATTTGATTTTTTGAGACAGG - Intronic
1031109091 7:117583839-117583861 ATTTTTTGACTTTTTAATTGTGG + Intronic
1031419733 7:121536978-121537000 ATAATTTGACTGTTTACTTGTGG + Intergenic
1032869058 7:135961371-135961393 TGATTTTGACTTTTTAATTTTGG - Intronic
1033205362 7:139415803-139415825 AGAAATACTCTTTTTAAGTGTGG + Intronic
1034634643 7:152557437-152557459 ATAATTTGATTTTTTAAGAATGG + Intergenic
1035915273 8:3613576-3613598 AGAATATGAGTTTTTAACTTAGG + Intronic
1036067177 8:5394943-5394965 ACAATTCGATCTTTTAAGTGAGG + Intergenic
1037072190 8:14664974-14664996 ACCATTTGAATTTTTAGGTGGGG + Intronic
1038059623 8:23898708-23898730 TGAATTTGACTTTATTTGTGTGG - Intergenic
1039320578 8:36425920-36425942 AGAAATTGACTTCTTAAATTTGG - Intergenic
1039640122 8:39210247-39210269 TGAATTTGTCTTTTTAGGAGAGG - Intronic
1040658198 8:49537652-49537674 TAAATTTGACTTTTTCAGAGTGG - Intronic
1040880240 8:52197022-52197044 AGAATTTTACATTTTAATGGAGG + Intronic
1042043746 8:64624219-64624241 ATAATTTGATTTTTAATGTGAGG + Intronic
1043077839 8:75724198-75724220 AGAAGATGAATTTTTAAATGGGG + Intergenic
1043264802 8:78251737-78251759 AGACTTTGACTTTTTATTTAGGG - Intergenic
1043298505 8:78697417-78697439 AGAATTTGACTTTTTAAGTGCGG - Exonic
1043775356 8:84260610-84260632 AGAAGTTGCCTTTTGAAGAGAGG + Intronic
1045959463 8:107950030-107950052 AGTATTAGACTTCTCAAGTGGGG - Intronic
1045995402 8:108356652-108356674 TGGATTAGACTTTTTCAGTGAGG - Intronic
1046174758 8:110560798-110560820 TGCCTTTGTCTTTTTAAGTGAGG + Intergenic
1046564979 8:115887294-115887316 AGTATTTGATTTTTTGAATGAGG - Intergenic
1046723511 8:117649966-117649988 ATAATTTTAATTTTCAAGTGTGG + Intergenic
1046765203 8:118061561-118061583 AGAATTTACCTTTTTATGTTTGG - Intronic
1047014435 8:120708707-120708729 AGTATATGACTACTTAAGTGAGG + Intronic
1047900332 8:129414426-129414448 AGAATTTGAGCTTTAAAGTCAGG - Intergenic
1050272738 9:3963197-3963219 AGAGTCTTATTTTTTAAGTGAGG - Intronic
1050483587 9:6111152-6111174 ACAATTTGTCTTTATCAGTGTGG + Intergenic
1050771967 9:9213479-9213501 GGCATTTGATTTTTCAAGTGCGG - Intronic
1052629232 9:31016159-31016181 AGTTTTTGACTTTTTAATAGTGG - Intergenic
1052914828 9:33916808-33916830 AAACTTTGACTTTTTAGGAGGGG - Intronic
1054785728 9:69208533-69208555 AAAATTTTATTTTTTAAATGTGG - Intronic
1055151921 9:73010966-73010988 AGAAATTGATTTTTTTAATGTGG - Intronic
1055423136 9:76164557-76164579 AGAATTAGACTTTTTGGGAGAGG - Intronic
1056304157 9:85272765-85272787 AGTCTTTGTCTTTTTAAATGTGG + Intergenic
1056833498 9:89935080-89935102 AGAAATAGACTTTGAAAGTGGGG - Intergenic
1056871204 9:90281773-90281795 AGCGTTTGACTATTTAAGCGAGG - Intergenic
1057032248 9:91784750-91784772 AGTATTTGACATTTTGAGTAGGG - Intronic
1058180509 9:101792400-101792422 AGAGTTTGACCTTGAAAGTGTGG + Intergenic
1059074682 9:111180197-111180219 AGAACATGACTTTTCAAGTCAGG - Intergenic
1059741218 9:117151859-117151881 AGAAGTGGAATTTTTAAATGAGG - Intronic
1059874257 9:118616576-118616598 ACAAGTTGTCTTATTAAGTGGGG + Intergenic
1186035404 X:5416911-5416933 AGAATTATAAATTTTAAGTGAGG + Intergenic
1186129262 X:6448680-6448702 AGAATTTAAAATTTTAAATGAGG - Intergenic
1186219285 X:7332448-7332470 AGAATTTTACTTTTTGAATCTGG - Intronic
1186226181 X:7401273-7401295 AGACTTTGTTTTTTTAAGTCTGG - Intergenic
1186787265 X:12965262-12965284 AGAATTTAACTTGTGAAGTTTGG - Intergenic
1188163107 X:26826866-26826888 AAAGTATGACTTTTTAAATGAGG + Intergenic
1188530539 X:31135510-31135532 ACATTTTGACTGTTTATGTGAGG + Intronic
1189546580 X:42048534-42048556 AGTATTGGACATTTTAAGTATGG - Intergenic
1190040922 X:47071473-47071495 ATAAACTGACTTTTTAAGTTGGG - Intergenic
1192722076 X:73709695-73709717 TCAATTTGAATTTTTTAGTGGGG + Intergenic
1194350501 X:92820664-92820686 AGAATTTGGATTTTTTCGTGGGG - Intergenic
1194496048 X:94617809-94617831 AGAATTTCACCTTTGGAGTGAGG - Intergenic
1196462373 X:115943987-115944009 AGACTTTCTCTTCTTAAGTGAGG + Intergenic
1196598952 X:117578924-117578946 GTACTTTGACTTTTTAATTGTGG + Intergenic
1197265174 X:124361741-124361763 AAAAATTGACTTTTTATCTGAGG + Intronic
1197354315 X:125418049-125418071 AGAATATTTTTTTTTAAGTGGGG - Intergenic
1198316567 X:135473148-135473170 AAATATTGACTTTTTAAGTGTGG + Intergenic
1199529923 X:148834805-148834827 TGAATTAGACTTGTAAAGTGTGG - Intronic
1199901966 X:152183922-152183944 ATAATTTTTCTTTTTAAGTTTGG + Intronic
1199907036 X:152243098-152243120 AGTATTTGTCTTTCTGAGTGTGG - Intronic
1200572367 Y:4848072-4848094 ATATTTTGATTTTTTAATTGTGG - Intergenic
1201451023 Y:14115507-14115529 AGATTTTGACTTTTTTGATGTGG + Intergenic
1201547325 Y:15180028-15180050 AGATTTTGATGTATTAAGTGTGG + Intergenic
1201611558 Y:15848650-15848672 AGAATTTAAAATTTTAAATGAGG - Intergenic
1201853182 Y:18511281-18511303 TGAAGTTGACTTATTAACTGTGG - Intergenic
1201880139 Y:18809103-18809125 TGAAGTTGACTTATTAACTGTGG + Intronic