ID: 1043298508

View in Genome Browser
Species Human (GRCh38)
Location 8:78697440-78697462
Sequence GATCCTGATGATGCAGTTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 315}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043298508_1043298509 1 Left 1043298508 8:78697440-78697462 CCTGGAACTGCATCATCAGGATC 0: 1
1: 0
2: 2
3: 38
4: 315
Right 1043298509 8:78697464-78697486 TCACGATTACCGCAGCCAAGTGG 0: 1
1: 0
2: 0
3: 1
4: 33
1043298508_1043298513 22 Left 1043298508 8:78697440-78697462 CCTGGAACTGCATCATCAGGATC 0: 1
1: 0
2: 2
3: 38
4: 315
Right 1043298513 8:78697485-78697507 GGCGCTGGCAAAACTGTTGTAGG 0: 1
1: 0
2: 0
3: 9
4: 66
1043298508_1043298510 7 Left 1043298508 8:78697440-78697462 CCTGGAACTGCATCATCAGGATC 0: 1
1: 0
2: 2
3: 38
4: 315
Right 1043298510 8:78697470-78697492 TTACCGCAGCCAAGTGGCGCTGG 0: 1
1: 0
2: 0
3: 2
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043298508 Original CRISPR GATCCTGATGATGCAGTTCC AGG (reversed) Exonic
902271890 1:15310582-15310604 GATGCTGATGCTGCTGGTCCAGG - Intronic
903300045 1:22372335-22372357 GATGCTGATGCTGCCGGTCCAGG - Intergenic
903942251 1:26939825-26939847 GATGCTGATGCTGCAGGTCAGGG + Intronic
904734302 1:32618805-32618827 GATCCTCTTGATTCAGTTCTAGG - Intronic
904975230 1:34451093-34451115 GATGCTGATGCTGCTGGTCCAGG - Intergenic
905279885 1:36842291-36842313 GATGCTGATGCTGCAGGTGCAGG - Intronic
906269647 1:44465644-44465666 GATGTTGAAGATTCAGTTCCAGG + Intronic
908793779 1:67810979-67811001 GATGCTGATGCTGCCGGTCCAGG - Intronic
910114137 1:83713994-83714016 GATGCTGAGGAGGCAGCTCCTGG + Intergenic
911779022 1:101851968-101851990 GATGCTGATGCTGCAATTCTTGG + Intronic
911894795 1:103418945-103418967 GATGGTGATGATGCAGTTTCAGG + Intergenic
913260001 1:116989221-116989243 CATACTGATGCTGCAGTTCAGGG + Exonic
916250758 1:162735524-162735546 GATGCTGATGCTGCTGGTCCTGG + Intronic
917134870 1:171780235-171780257 GATGCTGATGATGTTGGTCCCGG - Intergenic
917448603 1:175127777-175127799 GATCCTGAAGCTGCAGTCCTGGG + Intronic
918068067 1:181114943-181114965 GATACTGATGCTGCTGGTCCAGG - Intergenic
918468101 1:184842377-184842399 GATGCTGATGCTACAGGTCCAGG + Intronic
918594668 1:186279186-186279208 GATGCTGATGCTGCTGGTCCAGG - Intergenic
920851096 1:209628157-209628179 GATCCGGATGGGGCAGTGCCAGG - Exonic
920932929 1:210405962-210405984 GATACTGATGCTGCTGGTCCAGG - Intronic
922033090 1:221823361-221823383 GATGCTGATGCTGCTGGTCCAGG + Intergenic
922661499 1:227434283-227434305 GATGACGATGATGAAGTTCCAGG + Intergenic
923160942 1:231314056-231314078 GATTCTGATGCTGCAGCTCTGGG - Intergenic
923218864 1:231875026-231875048 CATCCTGATGATGCTCTGCCTGG - Intronic
923604746 1:235433040-235433062 GGCACTGATGATGCAGTTGCTGG - Intronic
923962007 1:239096366-239096388 GAATCTGCTGATGCAGTCCCTGG + Intergenic
924579565 1:245312142-245312164 GATCCTGATGAACCACTTCCTGG + Intronic
1062763778 10:46462-46484 CATCGTGATGATGGAGTGCCTGG + Intergenic
1063407017 10:5805693-5805715 GATACTGATGATGCTGGTCCAGG + Intronic
1063433931 10:6015441-6015463 GATACTGACGCTGCCGTTCCAGG - Intronic
1063914165 10:10864519-10864541 GTACCTGTTGATTCAGTTCCAGG + Intergenic
1065334015 10:24636313-24636335 GATACTGATGCTGCTGGTCCTGG - Intronic
1066217855 10:33305445-33305467 GATCGTGATTATGCATTACCTGG + Intronic
1067103945 10:43352411-43352433 GATCATGATTATGCAGTTACTGG + Intergenic
1067220385 10:44339871-44339893 GATGCTGATGCTGCCGGTCCAGG + Intergenic
1067311780 10:45120637-45120659 GATGCTGATGTTGCTGTTCTGGG + Intergenic
1067791644 10:49292886-49292908 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1068012776 10:51475283-51475305 GATGCTGATGCTGCTGTTCCAGG - Intronic
1068222326 10:54059684-54059706 GATGCTGATGCTGCTTTTCCAGG + Intronic
1070742676 10:78913115-78913137 GATGCTGATGCTGCTGGTCCTGG + Intergenic
1071048810 10:81419963-81419985 GATACTGATGCTGCTGGTCCAGG + Intergenic
1071360053 10:84837674-84837696 GAACCTGTTGGTGCAGTTCCAGG - Intergenic
1071402019 10:85282590-85282612 GATGCTGATGCTGCTGCTCCAGG - Intergenic
1072576377 10:96704383-96704405 GATGCTGATGCTGCTGGTCCAGG - Intronic
1074143300 10:110695996-110696018 GATGCTGATGCTGCTGGTCCAGG - Intronic
1075329256 10:121560932-121560954 GATGCTGATGCTGCTGGTCCAGG + Intronic
1075608317 10:123832217-123832239 GATGCAGGAGATGCAGTTCCTGG - Intronic
1078522544 11:12074961-12074983 GTTCATGCTGTTGCAGTTCCTGG + Intergenic
1079514331 11:21249000-21249022 GATCCTGATGATACTGTTGCTGG + Intronic
1081740068 11:45432982-45433004 GACCCTGATGATTAAGTCCCGGG + Intergenic
1087756704 11:102062185-102062207 GGTCCAGATGATTCAGTTGCTGG - Intronic
1088222858 11:107588269-107588291 GATCCTGGTGAAGCAATTCTAGG + Intergenic
1089114193 11:116080958-116080980 GATGTTGATGCTGCAGGTCCGGG + Intergenic
1089331511 11:117692147-117692169 GTTCCTAATGATGCAGTCCTTGG + Intronic
1089640880 11:119846492-119846514 GTGCCGGATGATTCAGTTCCTGG + Intergenic
1091839037 12:3605961-3605983 GAACCTGAGTATGCAGTTCGGGG - Intergenic
1094270697 12:28611303-28611325 GTTCCTGATGATGTAGTTACAGG + Intergenic
1095702114 12:45201226-45201248 GAACCTGCTGCTGCAGTTCTGGG - Intergenic
1096251527 12:50036091-50036113 GATGCTGATGTTGCAGATCTGGG + Intergenic
1096332271 12:50724221-50724243 GTTGCTGTTGATGCAGTTCGTGG + Intronic
1096429399 12:51530852-51530874 GAGCCTGATGCTGGAGGTCCAGG + Intergenic
1097301545 12:58024480-58024502 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1097460823 12:59859656-59859678 GATGCTAATGATGCTGGTCCAGG + Intergenic
1099632908 12:85173709-85173731 GATCCTCATGATGGAATTACTGG - Intronic
1100146258 12:91681508-91681530 GATCCTGCAAATGCAGTTGCTGG - Intergenic
1100213585 12:92424331-92424353 GATTCTGATGCTGCTGTTCCAGG - Exonic
1100527963 12:95437839-95437861 GATGCTGATGTTGCTGGTCCAGG - Intergenic
1100730727 12:97465031-97465053 GATTCGGATGATGCAGCTCTAGG + Intergenic
1101193573 12:102360214-102360236 GATCATGATGGTTGAGTTCCTGG + Intergenic
1101555072 12:105801274-105801296 GATGTTGATGCTGCAGGTCCAGG - Intergenic
1101706719 12:107227406-107227428 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1102202272 12:111065760-111065782 GATGCTGATGCTGCTGGTCCAGG - Intronic
1102720249 12:115009794-115009816 GTTCTTGATGCTGCAGTTCAAGG + Intergenic
1102924481 12:116816225-116816247 GAAGCTGCTGATGCAGTTGCTGG + Intronic
1102969395 12:117154323-117154345 TATCTTGATGCTGCTGTTCCAGG + Intronic
1103065003 12:117890108-117890130 GATGCTGATGCTGCTGGTCCAGG + Intronic
1104484336 12:129136973-129136995 GATGCTGATGATGCTGTTGATGG - Intronic
1107729488 13:43334011-43334033 GATGTTGATGATGCTGGTCCAGG - Intronic
1108095111 13:46893403-46893425 GATGCTGATGCTGCTGGTCCAGG + Intronic
1108382686 13:49869233-49869255 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1110588462 13:77223605-77223627 GAAGCTGATGAGGCAGTTCATGG + Intronic
1112366000 13:98756001-98756023 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1114419040 14:22564618-22564640 GTGCATAATGATGCAGTTCCAGG + Intergenic
1115299970 14:31874235-31874257 GATCCTGAGGAAACAGTGCCCGG + Intergenic
1115522858 14:34250890-34250912 AATCCTGATGGTGCAGGTCTGGG - Intronic
1116112482 14:40604642-40604664 GTGCCTGATGATTCTGTTCCTGG + Intergenic
1116798119 14:49413454-49413476 GTTGCTGAAGATGCATTTCCAGG + Intergenic
1117022021 14:51580554-51580576 GATTCTGATGTTGCAGTTCTTGG - Intronic
1117904007 14:60565663-60565685 GATCTTGATGATGCTGGTACCGG + Intergenic
1119598543 14:75958557-75958579 AATCCAGGTCATGCAGTTCCTGG - Exonic
1119958930 14:78832875-78832897 GATCCTGTTGAAGCTGTACCAGG + Intronic
1121702306 14:95963748-95963770 GATGCTGATGCTGCCGGTCCTGG + Intergenic
1125289849 15:38133957-38133979 GATGCTGATGCTGCTGATCCAGG + Intergenic
1126924062 15:53562491-53562513 GATGCTGATGCTGCTGGTCCAGG + Intronic
1127723622 15:61726397-61726419 GCTCCTGATGAAGTTGTTCCTGG - Intergenic
1129207528 15:74045804-74045826 GATGCTGATGCCGCAGGTCCTGG - Exonic
1129918845 15:79300657-79300679 GATCCTGATGATGTAATGCCTGG + Intergenic
1130402813 15:83573402-83573424 GATGCTGATGTTGCTGGTCCAGG - Intronic
1130434805 15:83887049-83887071 GATGCTGATGCTGCAGGTCCAGG - Intronic
1131384131 15:91988727-91988749 GATGCTGATGCTGCTGGTCCAGG + Intronic
1131670056 15:94610341-94610363 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1131837925 15:96409088-96409110 GATCTTCATGTTTCAGTTCCAGG + Intergenic
1132028595 15:98422364-98422386 GATGCTGATGTTGCTGGTCCGGG + Intergenic
1132240947 15:100256672-100256694 GATCCTGGTGGTGCAGCTTCGGG + Intronic
1133907527 16:10035664-10035686 GATGCTGATGCTGCTGGTCCAGG + Intronic
1135046317 16:19158912-19158934 GATGCTGATGCTGCTGGTCCAGG + Intronic
1135953077 16:26933437-26933459 AACCCAGATGATGCAGTTTCTGG + Intergenic
1137507528 16:49067372-49067394 GATGCTGATGATGCTGGTCCAGG - Intergenic
1138237334 16:55395748-55395770 GATACTGATGTTGCTGGTCCAGG - Intronic
1138939439 16:61772751-61772773 GAGGCTGATGCTGCAGGTCCAGG - Intronic
1139821764 16:69726666-69726688 GATGCTGAGGCTGCAGCTCCAGG + Exonic
1140262622 16:73393380-73393402 GTTCCTGATACTGCAGTTCCTGG + Intergenic
1140268168 16:73438341-73438363 GATGCTGATAATGCAGTCACTGG + Intergenic
1140870955 16:79106074-79106096 GATTCTGATGCTGCTGATCCAGG - Intronic
1141106898 16:81241494-81241516 GATGCTTATGCTGCAGGTCCGGG - Intronic
1141476903 16:84280165-84280187 GATCCTTATTATGCAGCGCCTGG - Intergenic
1144088586 17:11833066-11833088 GATGCTGATGCTGCTGGTCCAGG + Intronic
1144099390 17:11930586-11930608 GATGCTGATGCTGCTGGTCCAGG - Intronic
1144194242 17:12875212-12875234 GATGCTGATGCTGCTGGTCCAGG + Intronic
1144686848 17:17231751-17231773 CATGCTGAAGAAGCAGTTCCAGG - Intronic
1146488015 17:33259898-33259920 GATGCTGATGCTGCTGGTCCTGG + Intronic
1149269998 17:54967671-54967693 GATGCTGATGCTGCCGGTCCTGG + Intronic
1149392620 17:56207193-56207215 GATGCTGATGCTGCTGTTCAGGG - Intronic
1150729417 17:67678941-67678963 GATGCTGACGTTGCAGGTCCAGG - Intronic
1150834764 17:68554542-68554564 GATGTTGATGATGCTTTTCCTGG + Intronic
1150918242 17:69457853-69457875 GATCCTGATGCAGCAGCTCTGGG - Intronic
1151287063 17:73119806-73119828 GATGCTGATGTTGCTGGTCCAGG - Intergenic
1151372912 17:73660302-73660324 GATGCTGATGATGCTGGTCCAGG + Intergenic
1151737512 17:75953697-75953719 GATGCTGATGCTGCTATTCCAGG - Intronic
1152956688 18:46795-46817 CATCGTGATGATGGAGTGCCTGG + Intergenic
1153555594 18:6310080-6310102 GATGCTGATGCTGCTGGTCCAGG + Intronic
1154341858 18:13510088-13510110 GATGCTGCAGATTCAGTTCCAGG - Intronic
1154346141 18:13545164-13545186 GATGCTGCTGATGGAGTACCTGG + Intronic
1155566082 18:27135988-27136010 GACCCTGATGCTGCAGATCCAGG - Intronic
1155811887 18:30247417-30247439 GGTACTAATTATGCAGTTCCAGG - Intergenic
1155973738 18:32106363-32106385 TATCCAGAAGATGCAGTTCTAGG + Intronic
1156367182 18:36440168-36440190 GATGCTGATGCTGCTGGTCCAGG + Intronic
1157672348 18:49541057-49541079 GATACTGATGCTGCTGGTCCAGG + Intergenic
1157710434 18:49846356-49846378 GATGCTGATGCTGCTGGTCCAGG + Intronic
1157994944 18:52543819-52543841 CATCCTGTTGAGGCACTTCCTGG + Intronic
1158857387 18:61556473-61556495 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1161689444 19:5722611-5722633 GATCTTGATGCTGCTGGTCCAGG - Intronic
1163080876 19:14941245-14941267 GATGCTGATGGGGCTGTTCCAGG + Intergenic
1165089578 19:33376577-33376599 GATGATGATGATGCTGGTCCAGG + Intronic
925358787 2:3262777-3262799 GGTCCTGATAATGGAGCTCCTGG + Intronic
925505174 2:4554471-4554493 GTACCTGCTGATTCAGTTCCTGG + Intergenic
927251527 2:20998885-20998907 GATCAATAAGATGCAGTTCCTGG - Intergenic
927977516 2:27350242-27350264 GATACTGATGCTGCAGTTTCTGG - Intronic
928586526 2:32764254-32764276 GATACTGTAGATTCAGTTCCAGG + Intronic
928941760 2:36734038-36734060 GATGCTGATGCTGCCGGTCCAGG - Intronic
929853622 2:45616038-45616060 GATCCTGATGATGCCATGGCTGG + Intergenic
930804741 2:55479160-55479182 GATGCTGATGCTGCTGGTCCAGG + Intergenic
930920733 2:56750557-56750579 CATCCTGAGCATGCAGGTCCTGG + Intergenic
931731144 2:65154472-65154494 GATGCTGATGCTGCTGGTCCAGG - Intergenic
932130730 2:69185115-69185137 GATGCTGATGCTGCTGTTCCAGG - Intronic
932416744 2:71578199-71578221 GATGCTGATGCTGCTGGTCCAGG + Intronic
932443104 2:71750471-71750493 GATGCTGATGCTGCTGGTCCAGG + Intergenic
932744746 2:74324522-74324544 GCTGCTGATGATGCTGATCCAGG + Intronic
935557492 2:104526257-104526279 GATGCTGATGCTGCTGGTCCAGG + Intergenic
938953718 2:136280040-136280062 GATCATGATGATGCACCACCTGG - Intergenic
939338042 2:140856234-140856256 GATACTGATGATGAAATTCTAGG - Intronic
939680219 2:145121545-145121567 GATTCTGATTCTGCAGGTCCAGG + Intergenic
939691087 2:145261136-145261158 GTTCATAATGATGCAGTCCCTGG - Intergenic
940427900 2:153551928-153551950 AATCCTTATGGTGCAGTCCCAGG - Intergenic
941746762 2:169095197-169095219 GATGCTGATGCTGCTGGTCCAGG - Intronic
941906828 2:170724760-170724782 GATGCTGATGCTGCAGGTCTGGG - Intergenic
942403602 2:175629633-175629655 GATGCTGATGGTGCTGTTTCAGG - Intergenic
942659193 2:178246234-178246256 GATCTTACTGATGCAGTTTCAGG - Intronic
942901505 2:181125492-181125514 GGTCCAGGTGATGCAGTGCCTGG - Intergenic
945194806 2:207227959-207227981 GAAGCTGCTGCTGCAGTTCCCGG + Intergenic
945223503 2:207508155-207508177 GATGCTGATAATGCTGGTCCAGG - Intergenic
945435824 2:209816630-209816652 GATGCTGATGCTGCTGGTCCAGG + Intronic
945485992 2:210396268-210396290 GATGCTGATGATGCTGCTTCAGG + Intergenic
945746371 2:213723898-213723920 CATGCTGATGAGGCACTTCCTGG - Intronic
947182523 2:227424131-227424153 GATCCTGATTCAGCAGTTCTGGG - Intergenic
1168850202 20:971324-971346 GATGCTGATGCTGCTGGTCCAGG + Intronic
1168863422 20:1062991-1063013 GATGGTGATGATGCTGGTCCTGG + Intergenic
1169270882 20:4198574-4198596 GATGCTGATGCTGCTGTTCAGGG - Intergenic
1169368941 20:5013655-5013677 GATGCTGATGATGCAGTTGCTGG + Intergenic
1169509199 20:6245409-6245431 GATGCTGATGCTGCTGTTCCAGG + Intergenic
1169866723 20:10209115-10209137 CTTCCTGATGATGCAGTCTCAGG + Intergenic
1170518815 20:17161700-17161722 GATCCTGATGCTGCTAGTCCAGG + Intergenic
1170672992 20:18452296-18452318 GATGCTGATGCTGCAGGTCTGGG + Intronic
1171367239 20:24633622-24633644 GACCCTGATGCTGCTGGTCCAGG - Intronic
1171377674 20:24704490-24704512 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1172413007 20:34740548-34740570 GGTCCTGCTGAGGCAGTGCCCGG + Exonic
1173061609 20:39667014-39667036 GACCCTGCTGATGCAGTGCCAGG + Intergenic
1173704392 20:45099215-45099237 GATGCTGATGCTGCTGGTCCGGG - Exonic
1174207664 20:48852566-48852588 GATCCTGATGGAGCAGATCTGGG + Intergenic
1174739452 20:52997978-52998000 GATTCTGATGAAGCAGGTCTGGG - Intronic
1175573660 20:60043299-60043321 GATGCTGATGCTGCCGGTCCAGG - Intergenic
1175579967 20:60090777-60090799 GATTCTGCTGAAGCAGCTCCTGG - Intergenic
1176169242 20:63689591-63689613 TGTCCTCAAGATGCAGTTCCTGG + Exonic
1178094961 21:29204841-29204863 GATACTGATGCTGCAGTTCTGGG - Intronic
1181913166 22:26256683-26256705 GATGCTGATGCTGCTGGTCCAGG - Intronic
1182548306 22:31088015-31088037 GCTCCTGCCGCTGCAGTTCCCGG - Exonic
1183093109 22:35536837-35536859 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1184076521 22:42182685-42182707 GTTGCTGATGCTGCTGTTCCAGG - Intronic
949961711 3:9317772-9317794 GATGCTGATGCTGCTGGTCCAGG + Intronic
951192899 3:19790882-19790904 GATGCTGATGATGCTGGTCCAGG + Intergenic
951575380 3:24107979-24108001 GATGCTGATGTTGCAGCTCTGGG - Intergenic
951594676 3:24305177-24305199 GATGCTGATGTTGCTGATCCAGG - Intronic
951709250 3:25572783-25572805 GACCCTGATGTAGCAGTTACTGG - Intronic
952258498 3:31716073-31716095 GATTCTGCTGCTGCAGGTCCAGG - Intronic
952534962 3:34299698-34299720 GATGCTGATTATGCAGTTCCAGG - Intergenic
952740410 3:36728912-36728934 GATGCTGATGGTGCTGGTCCAGG - Intronic
953344399 3:42163232-42163254 GATCCTGATGCTGCTGGTCAGGG - Intronic
953704879 3:45223696-45223718 GATGCTGATGTTGCTGGTCCAGG + Intergenic
953827541 3:46267081-46267103 GATGCTGATGATGCTGGTCCTGG + Intergenic
954638390 3:52084016-52084038 GAGCCTGGTGAGGCAGTGCCAGG - Intronic
954642944 3:52112908-52112930 GATGCTGATGCTGCTGATCCAGG - Intronic
955386231 3:58483206-58483228 AATTCTGATAATGCAGTGCCTGG - Intergenic
955531156 3:59874510-59874532 GATGCTGATGCTGCTGGTCCAGG + Intronic
955704055 3:61709956-61709978 GCTGCTGATGCTGCTGTTCCTGG + Intronic
956319755 3:67983840-67983862 GATACTGATCTTGCAGATCCAGG - Intergenic
956647197 3:71467862-71467884 GATGCTGATGCTGCAGTACAGGG + Intronic
956899899 3:73704467-73704489 GATTCTGATGCTGCAGTTTGGGG + Intergenic
958729460 3:97946160-97946182 AATCCTGAAGATGCTCTTCCAGG - Intronic
960044124 3:113179755-113179777 GACCCTGTGGATGCAGTTCGAGG + Intergenic
960047230 3:113210638-113210660 GATGCTGATGCTGCAGGTCAGGG - Intergenic
961860095 3:129909855-129909877 GATGCTGATGCTGCTGTTCCAGG - Intergenic
963524700 3:146403459-146403481 GATGTTGATGCTGCTGTTCCAGG + Intronic
963690541 3:148495789-148495811 GATGCTGATGCTGCAGGTCCAGG + Intergenic
964229916 3:154453897-154453919 GATACTGATGCTGCTGTCCCAGG + Intergenic
964596796 3:158441627-158441649 GATGCTAATGTTGCAGTTCTAGG - Intronic
965165089 3:165187785-165187807 GATCGTGAGGATGGAGTTACTGG + Exonic
966266826 3:178056150-178056172 GATCCTGATTCAGTAGTTCCTGG - Intergenic
966584335 3:181604778-181604800 GATGCTGATGCTGCTGTTTCAGG + Intergenic
966927526 3:184655098-184655120 GATGCTGATGTTGCTGGTCCAGG + Intronic
967113197 3:186313572-186313594 GATGCTGATGCTGCTGGTCCAGG - Intronic
967738550 3:192980313-192980335 GATGCTGATGCTGCTGATCCAGG + Intergenic
967970836 3:194998393-194998415 GATGCTGATGCTGCTGGTCCTGG - Intergenic
972909519 4:43797387-43797409 GGTCATGAGGAAGCAGTTCCAGG + Intergenic
973755322 4:54068143-54068165 GTTCCTGATGATTTGGTTCCTGG - Intronic
975383191 4:73726477-73726499 GATGCTGATGATGCTTGTCCAGG - Intergenic
975579468 4:75893605-75893627 GATTCTGATGTTACAGGTCCAGG - Intronic
979341503 4:119529906-119529928 GATGCTGATGCTGCTGGTCCAGG - Intronic
980076775 4:128302294-128302316 GATTCTGATGCTGCAGGTCCAGG - Intergenic
981895189 4:149790067-149790089 GATGCTGCAGATGAAGTTCCTGG - Intergenic
981947284 4:150362630-150362652 GATACTGATGCTGCTGGTCCAGG + Intronic
983701481 4:170600714-170600736 GATGCTGATGTTGCTGGTCCAGG - Intergenic
983905506 4:173177228-173177250 GATGCTGATGCTGCTGGTCCAGG + Intronic
985686223 5:1283111-1283133 TATCCGGATGGTGCAGGTCCGGG - Intronic
985686278 5:1283354-1283376 TATCCAGATGGTGCAGGTCCGGG - Intronic
985686440 5:1284029-1284051 TATCCGGATGGTGCAGGTCCGGG - Intronic
985686454 5:1284090-1284112 AGTCCGGATGATGCAGGTCCGGG - Intronic
985686483 5:1284211-1284233 AGTCCGGATGATGCAGGTCCGGG - Intronic
985686512 5:1284332-1284354 AGTCCGGATGATGCAGGTCCGGG - Intronic
985686662 5:1285010-1285032 AGTCCGGATGATGCAGGTCCGGG - Intronic
985686691 5:1285131-1285153 AGTCCGGATGATGCAGGTCCGGG - Intronic
988427425 5:31079826-31079848 GATACTAATGCTGCAGTTCTGGG - Intergenic
988534719 5:32056778-32056800 AATCTTGCTGATGCAGTTCCAGG - Intronic
988625126 5:32866697-32866719 GATGCTGATGCTGCTGGTCCAGG + Intergenic
988706880 5:33735313-33735335 GATGCTGATGCTGCTGGTCCGGG + Intronic
990853297 5:60232443-60232465 GAGACTGATGCTGCAGTGCCAGG - Intronic
992112064 5:73504382-73504404 GATGATGATGATGAAGTTCCAGG + Exonic
993080717 5:83295781-83295803 GATCCAGATCATGCAGAGCCTGG + Intronic
993600143 5:89912443-89912465 GATGCTGATGCTGCAGGTTCCGG - Intergenic
995978749 5:118075769-118075791 GATGCTGATGCTGCCATTCCAGG + Intergenic
996017031 5:118551029-118551051 GATGCTGATGCTACAGGTCCAGG + Intergenic
996868968 5:128164221-128164243 GATGCTGCTGATTCAGTTCAGGG + Intronic
997152579 5:131514364-131514386 ACTTCTGAAGATGCAGTTCCTGG + Intronic
997614284 5:135235934-135235956 GATGCTGATGTTGCTGGTCCAGG + Intronic
999626677 5:153528581-153528603 GATGCTGATGCTGCTGGTCCAGG + Intronic
1000361315 5:160450285-160450307 GTGCCAGATGATTCAGTTCCTGG + Intergenic
1001228253 5:169963930-169963952 GATGCTGCTGCTGCAGCTCCAGG + Intronic
1001275323 5:170346566-170346588 GACATTGATGATGCAGTTCCTGG + Intergenic
1001279602 5:170377348-170377370 GATCCTGATGCTGCTGGCCCAGG + Exonic
1001766064 5:174248103-174248125 GATCCTGATGCTGCCGCTCTGGG - Intergenic
1005630922 6:27707141-27707163 GATGCTGATGTTGCTGGTCCAGG - Intergenic
1006170959 6:32092254-32092276 GATGCTGATGCTGCAGGTCCAGG + Intronic
1007034262 6:38658515-38658537 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1012430018 6:99154247-99154269 GAACCTGATGAAGCAGCTCAGGG - Intergenic
1013309920 6:108884264-108884286 GATGCTGATGCTGCTGGTCCAGG - Intronic
1013350227 6:109299043-109299065 GAGCCTGATCAGGCAGATCCAGG - Intergenic
1014241309 6:119021047-119021069 GATGCTGGTGATGCTGGTCCTGG - Intronic
1014774762 6:125495476-125495498 GATACTGATGCTGCTGTTCTGGG + Intergenic
1016884928 6:148950267-148950289 GATGCTGATGCTGCAGGTCTGGG + Intronic
1018834968 6:167476127-167476149 GATCCTGAGGATGCTGGCCCTGG - Intergenic
1019441140 7:1047710-1047732 CATCCTGAGGATGCAGTGCCTGG + Intronic
1019925030 7:4186299-4186321 GGTCCTGCTCTTGCAGTTCCTGG - Intronic
1020348095 7:7186428-7186450 GATGATGATGCTGCAGATCCAGG - Intronic
1020939889 7:14518945-14518967 GATTGTGATGCTGCTGTTCCAGG + Intronic
1021180228 7:17497443-17497465 GATTCTAATGAAGCTGTTCCAGG + Intergenic
1021548619 7:21844626-21844648 GATGGTGATGCTGCTGTTCCAGG - Intronic
1022128498 7:27380467-27380489 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1022971049 7:35517640-35517662 GATGCTAATGATGCTGTTCCAGG + Intergenic
1023044842 7:36201963-36201985 GATGCTGATGCTGCTGGTCCAGG - Intronic
1023115428 7:36857329-36857351 GATCCTGATCATGTAGATCTAGG + Intronic
1023760656 7:43462439-43462461 GATCCTGATGCTGCTGGCCCAGG - Intronic
1026280353 7:68916727-68916749 GATCCTGCTGGTGCACTTCTGGG - Intergenic
1027201379 7:76065917-76065939 GTTCCTGATGATTGAGTTCCTGG + Intronic
1028720822 7:94028843-94028865 GATTCTGATGCTGCTGTTCCTGG + Intergenic
1031431540 7:121676668-121676690 GATCCTGATGGTGCAGCTGGTGG + Intergenic
1031640494 7:124157760-124157782 TACCCTAATGATGCATTTCCTGG - Intergenic
1031977810 7:128104851-128104873 GATGCTGATGCTGCTGTTCTGGG - Intergenic
1032475434 7:132208542-132208564 GAACCTGATGTTGAAGCTCCTGG - Intronic
1033157634 7:138970669-138970691 GATGCTGATGCTGCTGATCCGGG + Intronic
1038029441 8:23624320-23624342 GATCCTGATTCAGCAGTTCTGGG + Intergenic
1041421098 8:57667614-57667636 GAACCTGATGATGCTTCTCCAGG - Intergenic
1042835784 8:73078203-73078225 GATCCTGATGCTGCTGATCCAGG + Intronic
1043298508 8:78697440-78697462 GATCCTGATGATGCAGTTCCAGG - Exonic
1045254788 8:100510328-100510350 GATCCTCAAGATGGAGCTCCAGG - Exonic
1046154280 8:110266922-110266944 GATGCTGATGATGCTGGTCTAGG - Intergenic
1046811778 8:118540888-118540910 GATCCTGATGGGGCAGTGACTGG + Intronic
1047310987 8:123691808-123691830 GATGCTGATGGTGCTGTTTCAGG + Intronic
1047627306 8:126669257-126669279 GAGCCAGATGAAGTAGTTCCTGG - Intergenic
1048454239 8:134563717-134563739 GATGATGAACATGCAGTTCCTGG + Intronic
1049740163 8:144236214-144236236 GATCCAGGTGATGCAGTTTTGGG + Intronic
1050250536 9:3739393-3739415 GATGCTGATGTTGCTGGTCCAGG - Intergenic
1051125579 9:13800865-13800887 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1052349405 9:27443145-27443167 GATCCTGATGCTGCTGGTCTAGG + Intronic
1053196622 9:36124914-36124936 GGTCCTGATGTTCCAGTTCCAGG + Intergenic
1053257702 9:36632197-36632219 GATGCTGATGCTGCAGGTCTTGG + Intronic
1054870894 9:70046236-70046258 GATGCTGATGATGCTGGTCTCGG + Intronic
1055023756 9:71697186-71697208 GATCCTGATGCTGCTGGTCTGGG + Intronic
1055296316 9:74837349-74837371 GATGCTGATGCTGCTGGTCCAGG + Intronic
1055412651 9:76047378-76047400 GATGCTGAGCATGCAGTTCAGGG + Intronic
1055715532 9:79113589-79113611 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1055868197 9:80841320-80841342 GATGCTGATGCTGCTGGTCCTGG - Intergenic
1056183698 9:84110886-84110908 CATCATGATGAAGCTGTTCCTGG + Intergenic
1056367689 9:85922069-85922091 GATCCTGATTCAGCAGGTCCAGG - Intergenic
1057985617 9:99710718-99710740 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1058350417 9:104014886-104014908 GATGCTGATGCTGCTGATCCAGG + Intergenic
1058623657 9:106911571-106911593 GATGCTGATGCTGCTGGTCCAGG + Intronic
1059393357 9:114014831-114014853 GATACTGATGTTGCTGGTCCAGG + Intronic
1060054007 9:120397896-120397918 GATGCAGATGCTGCAGGTCCAGG + Intronic
1060064550 9:120493049-120493071 GATACTGATTATGCTGTTCTAGG - Intronic
1060492430 9:124094729-124094751 GAGGCTGATGATGAAGTTGCAGG + Intergenic
1185853065 X:3507310-3507332 CATCCTGAAGATGTAGTTCCTGG + Intergenic
1186710678 X:12192821-12192843 GATGCTGATGCTGCTGATCCAGG + Intronic
1186764932 X:12761072-12761094 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1186996405 X:15128226-15128248 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1188022655 X:25175547-25175569 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1188024728 X:25196126-25196148 GACACTGATGCTGCTGTTCCTGG + Intergenic
1188350677 X:29127375-29127397 GATGCTGATGCTGCTGGTCCAGG + Intronic
1188538721 X:31225752-31225774 GATGCTGATGCTGCTGGTCCAGG + Intronic
1188578840 X:31685895-31685917 GATCCTGATGAAGGAGCTCTGGG - Intronic
1189124035 X:38426442-38426464 GATGCTGATGCTGCTGGTCCAGG + Intronic
1189206664 X:39245708-39245730 GATACTGATGATGCTGGTCCAGG + Intergenic
1189277741 X:39798992-39799014 GATGCTGATGCTGCTCTTCCAGG + Intergenic
1189553775 X:42120515-42120537 GATACTGATAATGCTGGTCCAGG - Intergenic
1189862893 X:45291593-45291615 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1189943913 X:46157403-46157425 GATGCTGATGCTGCTGGTCCGGG - Intergenic
1190827604 X:54031956-54031978 GATGCTGATGCTGCTGGTCCAGG + Intronic
1191112148 X:56812346-56812368 GATTCTGATTATGCACTTCAGGG - Intergenic
1194721522 X:97346172-97346194 GATGCTGATGTTGCTGGTCCAGG - Intronic
1195734127 X:107995923-107995945 GATCCTGAAGATCCAGATCATGG + Intergenic
1196425318 X:115562669-115562691 GATCCTCGAGATGCAGTTCATGG + Intronic
1197717401 X:129719386-129719408 GATGCTGATGTTGCTGGTCCAGG + Intergenic
1197760959 X:130027910-130027932 GCTCTTGATAATGGAGTTCCCGG + Intronic
1197793636 X:130279279-130279301 GATCCTGATGGAGGAGGTCCTGG - Intergenic
1199766362 X:150944492-150944514 GATGCTGATGCTGCTGGTCCGGG + Intergenic
1199951922 X:152714420-152714442 GATCCTGAGGCTGTAGATCCTGG - Intergenic
1199954567 X:152733598-152733620 GATCCTGAGGCTGTAGATCCTGG - Intronic
1199957761 X:152754028-152754050 GATCCTGAGGCTGTAGATCCTGG + Intergenic