ID: 1043298509

View in Genome Browser
Species Human (GRCh38)
Location 8:78697464-78697486
Sequence TCACGATTACCGCAGCCAAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 33}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043298503_1043298509 28 Left 1043298503 8:78697413-78697435 CCACCCGCACTTAAAAAGTCAAA 0: 1
1: 0
2: 0
3: 2
4: 123
Right 1043298509 8:78697464-78697486 TCACGATTACCGCAGCCAAGTGG 0: 1
1: 0
2: 0
3: 1
4: 33
1043298508_1043298509 1 Left 1043298508 8:78697440-78697462 CCTGGAACTGCATCATCAGGATC 0: 1
1: 0
2: 2
3: 38
4: 315
Right 1043298509 8:78697464-78697486 TCACGATTACCGCAGCCAAGTGG 0: 1
1: 0
2: 0
3: 1
4: 33
1043298504_1043298509 25 Left 1043298504 8:78697416-78697438 CCCGCACTTAAAAAGTCAAATTC 0: 1
1: 0
2: 3
3: 25
4: 274
Right 1043298509 8:78697464-78697486 TCACGATTACCGCAGCCAAGTGG 0: 1
1: 0
2: 0
3: 1
4: 33
1043298505_1043298509 24 Left 1043298505 8:78697417-78697439 CCGCACTTAAAAAGTCAAATTCT 0: 1
1: 0
2: 3
3: 31
4: 412
Right 1043298509 8:78697464-78697486 TCACGATTACCGCAGCCAAGTGG 0: 1
1: 0
2: 0
3: 1
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043298509 Original CRISPR TCACGATTACCGCAGCCAAG TGG Exonic
903296451 1:22346300-22346322 TCACGAGTCCCTCAGCCAGGTGG + Intergenic
907724169 1:57003254-57003276 GCTCGACTACAGCAGCCAAGTGG + Intronic
915524211 1:156466357-156466379 TTACAATTACAGTAGCCAAGAGG + Exonic
918888689 1:190234434-190234456 TCATAGTTACTGCAGCCAAGAGG + Exonic
920294014 1:204944848-204944870 TCCTGATTACTCCAGCCAAGAGG - Intronic
1078654844 11:13229141-13229163 TCACAATTATCCCACCCAAGGGG + Intergenic
1113591366 13:111503503-111503525 TCCTGATGACCCCAGCCAAGTGG - Intergenic
1122926381 14:104904813-104904835 TCACGTTCACCTCAGCTAAGAGG - Intergenic
1123003431 14:105309257-105309279 TCAGGATAACCACAGTCAAGAGG + Exonic
1144771054 17:17759862-17759884 TCAAGATTACAGCATCCTAGTGG - Intronic
1146703409 17:34981134-34981156 TCACAACTGCCGCAGCCCAGGGG - Intronic
1149085289 17:52709626-52709648 TCACGATGGCCACAGCCCAGAGG + Intergenic
1164920183 19:32083458-32083480 TCCTGATTACTGGAGCCAAGGGG - Intergenic
929229350 2:39543272-39543294 TCATGATTACTGTAGCAAAGTGG - Intergenic
1170329370 20:15191422-15191444 TCACTATAACTGCAGTCAAGAGG - Intronic
1183879900 22:40818781-40818803 TCACGCTTGCCGCGGGCAAGTGG - Intronic
961415415 3:126753162-126753184 ACACGATTTTGGCAGCCAAGGGG + Intronic
965824116 3:172713471-172713493 TGAGGATTAGCGCAGCCAAATGG + Intergenic
968661890 4:1802086-1802108 TCACGCAACCCGCAGCCAAGGGG - Intronic
982562438 4:156946538-156946560 TCACTATTACCTCAGAAAAGGGG - Intronic
984273363 4:177575475-177575497 TCATGAATACTGCAGTCAAGGGG - Intergenic
995883269 5:116866093-116866115 TCACGATTACAGGGGCCAAGGGG - Intergenic
997811771 5:136977623-136977645 ACAGGATTGCTGCAGCCAAGGGG + Exonic
1001369868 5:171188337-171188359 TCACCAACACAGCAGCCAAGAGG - Intronic
1006167505 6:32073650-32073672 TCACGATGACCACAGACAGGGGG + Intronic
1014365429 6:120534934-120534956 TCACCCTTACTGCATCCAAGGGG + Intergenic
1019198031 6:170293496-170293518 TCTCGATTACGGCGGCAAAGCGG + Intergenic
1031660538 7:124418833-124418855 GCAAGATTACCTCAGCCATGTGG - Intergenic
1032156630 7:129474800-129474822 TCAAGACTACCTCAGCCCAGCGG - Intronic
1043298509 8:78697464-78697486 TCACGATTACCGCAGCCAAGTGG + Exonic
1046046090 8:108966580-108966602 TCACGATGACAGCACCAAAGAGG - Intergenic
1048281866 8:133111885-133111907 TCAGGATGACCGAAGCCAGGAGG - Intronic
1049844178 8:144792152-144792174 TCACGATTAGCGCGGCCGGGCGG + Intronic
1052312552 9:27083631-27083653 TCAGGCTTACCTCAGCTAAGAGG + Intergenic
1053458498 9:38250369-38250391 TCACAGTGACCCCAGCCAAGGGG - Intergenic