ID: 1043301953

View in Genome Browser
Species Human (GRCh38)
Location 8:78744685-78744707
Sequence ACTTTTGCCGGGAAGCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043301950_1043301953 0 Left 1043301950 8:78744662-78744684 CCTGCTTTTCTGGAGTTGCAGTT No data
Right 1043301953 8:78744685-78744707 ACTTTTGCCGGGAAGCCTGAAGG No data
1043301948_1043301953 28 Left 1043301948 8:78744634-78744656 CCTAAGGGTATGCACAAGGATCT No data
Right 1043301953 8:78744685-78744707 ACTTTTGCCGGGAAGCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043301953 Original CRISPR ACTTTTGCCGGGAAGCCTGA AGG Intronic