ID: 1043302375

View in Genome Browser
Species Human (GRCh38)
Location 8:78749920-78749942
Sequence CCAGCTACTCAGGTTGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043302369_1043302375 5 Left 1043302369 8:78749892-78749914 CCATGCATGGTGGCACATGCTGG 0: 2
1: 12
2: 413
3: 7429
4: 31188
Right 1043302375 8:78749920-78749942 CCAGCTACTCAGGTTGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043302375 Original CRISPR CCAGCTACTCAGGTTGAAAT AGG Intronic
No off target data available for this crispr