ID: 1043302410

View in Genome Browser
Species Human (GRCh38)
Location 8:78750209-78750231
Sequence CTGCCCTGTACCACCTAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043302407_1043302410 3 Left 1043302407 8:78750183-78750205 CCTCTAGTTTTTCACATGTTGGA 0: 1
1: 0
2: 2
3: 12
4: 182
Right 1043302410 8:78750209-78750231 CTGCCCTGTACCACCTAAGGAGG No data
1043302405_1043302410 16 Left 1043302405 8:78750170-78750192 CCAGCTCAAGGGTCCTCTAGTTT 0: 1
1: 0
2: 1
3: 2
4: 67
Right 1043302410 8:78750209-78750231 CTGCCCTGTACCACCTAAGGAGG No data
1043302404_1043302410 17 Left 1043302404 8:78750169-78750191 CCCAGCTCAAGGGTCCTCTAGTT 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1043302410 8:78750209-78750231 CTGCCCTGTACCACCTAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043302410 Original CRISPR CTGCCCTGTACCACCTAAGG AGG Intronic
No off target data available for this crispr