ID: 1043305179

View in Genome Browser
Species Human (GRCh38)
Location 8:78784871-78784893
Sequence CTTTTCAAGGAGAAGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 403}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043305179 Original CRISPR CTTTTCAAGGAGAAGATGGA GGG (reversed) Intronic
900877105 1:5350629-5350651 CATTTGAAGGAGAAGGTGGAGGG + Intergenic
902691983 1:18115698-18115720 CTCTCCAAGGAGAACATAGAGGG - Intronic
902949218 1:19868585-19868607 CTCTTCTTGGAGAAGATGAAAGG - Intergenic
903002776 1:20278071-20278093 CTTTTCAAAGAGAAAAAGGAGGG - Intergenic
905779914 1:40699407-40699429 CTTTTAAAAGAGAAGAGAGAAGG + Intronic
907975525 1:59427739-59427761 ATTTTCCAGGAAATGATGGAAGG - Intronic
909915345 1:81311284-81311306 TTTTTCCGGGAGAAGATAGAAGG - Intronic
909996584 1:82287458-82287480 CTTATTAATGAAAAGATGGATGG + Intergenic
910053056 1:82998925-82998947 TTATTGAATGAGAAGATGGAAGG - Intergenic
911009476 1:93263908-93263930 CTTTTCCAGGTGAAGGTGCAAGG + Intronic
911229782 1:95348667-95348689 ATTTTCAAGGACAAATTGGAAGG + Intergenic
911527890 1:99007296-99007318 CATTTAAAGGAGAAGACAGAAGG - Intergenic
912062881 1:105696095-105696117 TTTTTCTAGGAAAAGATGAATGG - Intergenic
912981344 1:114376134-114376156 CATCTCAATGAGCAGATGGATGG - Intergenic
913446501 1:118955968-118955990 ATCTTCAAGGAGATTATGGATGG - Intronic
914097123 1:144553544-144553566 ATTTTCAAGCAGAACATGAAAGG - Intergenic
914258181 1:145977376-145977398 GTTTTAAAGGAGAGGAAGGAAGG - Intronic
914301871 1:146384066-146384088 ATTTTCAAGCAGAACATGAAAGG + Intergenic
914686501 1:149984557-149984579 AGTTTCAATGAGAAGATGGAAGG - Intronic
914956767 1:152169648-152169670 CTGTCCCAGGAGAAGAGGGAAGG + Intergenic
915438256 1:155925764-155925786 AATGTCAAGGAGAAGGTGGAAGG - Exonic
915499831 1:156307925-156307947 CTTTGCAAGGATGAGATGGGTGG + Intergenic
915999243 1:160598780-160598802 CTCTTCAAAGAGAAGAAGGATGG - Intergenic
916763189 1:167835204-167835226 CTTTTCATGGAGCAGCTGGCTGG - Intronic
916803499 1:168236286-168236308 CATTTGAATGAAAAGATGGATGG + Intronic
916861309 1:168808395-168808417 CAGTTCAGAGAGAAGATGGAGGG - Intergenic
917070020 1:171140391-171140413 CTTTTCTAAGAAAAGAAGGAAGG - Intronic
917167612 1:172130079-172130101 CTTTTCTAGTTGAAGAAGGAAGG - Intronic
918113567 1:181478899-181478921 CTTTTCCAGAAGAGGCTGGAGGG + Intronic
918277399 1:182966770-182966792 CTTTAGAAGGACAAGATGGGCGG - Intergenic
918626895 1:186666114-186666136 TTTTTTAAGGAAAAGATGCAAGG - Intergenic
919745983 1:201009453-201009475 CTGTCGAAGGAGAAGATTGAGGG - Exonic
920713169 1:208314995-208315017 CATCTCAAGGAGAAGATGAATGG + Intergenic
921069844 1:211649722-211649744 CTCTCCAAGGAGAGGATGAAAGG - Intergenic
921555809 1:216597417-216597439 CTGTGCATGAAGAAGATGGAAGG + Intronic
922013877 1:221622912-221622934 CTGTTGAAAGAGAAGATGGGAGG + Intergenic
922688420 1:227666603-227666625 CTACTCAAGGAGAAGCTGCAAGG - Intronic
922866441 1:228864961-228864983 CTTCTGTGGGAGAAGATGGAAGG + Intergenic
923032361 1:230259588-230259610 TTTTTCAAGGATAATCTGGAGGG + Intronic
924699326 1:246435156-246435178 CTATTAAAGGAGAAGAGGAAAGG + Intronic
1063198049 10:3761243-3761265 CTTCTCACAGAGAAGATGGCAGG + Intergenic
1063403552 10:5771192-5771214 CTGTTCAAGGAGAAAATAGTAGG - Intronic
1063696454 10:8340089-8340111 TTTTACAAAGAGAAGATAGAAGG - Intergenic
1063915269 10:10875674-10875696 CTTTTCTAGGATTAGATGTAAGG - Intergenic
1064245549 10:13665244-13665266 TTATTCAAACAGAAGATGGATGG - Intronic
1064448230 10:15416461-15416483 CAGATCAAGGAAAAGATGGAAGG + Intergenic
1064710838 10:18122668-18122690 GTTTTGAAAGAGAAGAAGGAAGG - Intergenic
1065062196 10:21914147-21914169 GTATTCAAGGACAAGATGCATGG - Intronic
1065659436 10:27990417-27990439 CTTTGGAAGGTGGAGATGGAAGG - Intronic
1067018506 10:42775335-42775357 CTTTCCAAGAGGAAGAGGGAAGG + Intergenic
1068455734 10:57251351-57251373 CTTTTCATCTATAAGATGGAAGG + Intergenic
1068993603 10:63177797-63177819 CATTTTAAGGAAAAGATTGAAGG - Exonic
1069589786 10:69634595-69634617 CTTTGCAAGGGGAAAATGAAAGG - Intergenic
1070426719 10:76295781-76295803 CATTGCAAGGAGAAAATGAAGGG - Intronic
1070584021 10:77747602-77747624 CTTTCAAAGGAGAAGATAAATGG - Intergenic
1070619704 10:77999723-77999745 CTGTTAGAGGAGAACATGGATGG - Intronic
1071593799 10:86902724-86902746 CTGTTCAGGGAGAAGAAGGTGGG - Intronic
1071694593 10:87858416-87858438 TTTTTCAAAGAGAAAATGCATGG - Intergenic
1072982936 10:100114962-100114984 CTCTTTAAGGAGGAGTTGGACGG - Intergenic
1073135089 10:101215931-101215953 CTTTTGAAGGAGAAGACGGTGGG - Intergenic
1073315373 10:102577032-102577054 CTCTTCAGGAAGAAGATGGGAGG + Intronic
1074394937 10:113089737-113089759 GTTTACAAGGAGAGGGTGGAGGG + Intronic
1074910015 10:117899928-117899950 CTATTGAATGGGAAGATGGAAGG - Intergenic
1075262025 10:120971291-120971313 CATTTCAAGGAGAAGGTAAAGGG + Intergenic
1075542759 10:123329310-123329332 CTTTCCAATGAGGAGAAGGAAGG - Intergenic
1078880338 11:15442030-15442052 TTTCTGCAGGAGAAGATGGATGG + Intergenic
1079240135 11:18716619-18716641 CTTTGCAAAAAGGAGATGGATGG + Intronic
1079590893 11:22181295-22181317 CTTCTTAAGGGGAAGATAGAGGG - Intergenic
1079649176 11:22905412-22905434 CTTTAAAACAAGAAGATGGAAGG - Intergenic
1080429805 11:32187888-32187910 CTTTTGGAGGCCAAGATGGATGG - Intergenic
1080807390 11:35666333-35666355 CTCTTGTAGGACAAGATGGAAGG - Intronic
1082873419 11:57964566-57964588 CTCTCCAAGGTGGAGATGGAAGG + Intergenic
1084253680 11:67923056-67923078 CTCTTCATGGAGATGATGCAAGG + Intergenic
1084819199 11:71672871-71672893 CTCTTCATGGAGATGATGCAAGG - Intergenic
1085472517 11:76767366-76767388 GTTTTCAAGCAGAAGCTGGGTGG + Intergenic
1085594350 11:77794437-77794459 CTTTGCAAGGACAAGGTGGGAGG + Intronic
1086532638 11:87803796-87803818 CGTGAAAAGGAGAAGATGGAAGG + Intergenic
1090853878 11:130594889-130594911 CTTTTCAAGAAGATGAGAGAAGG + Intergenic
1091001461 11:131913338-131913360 TTTTTCAAGGAAAAGGTGTAAGG + Intronic
1093489150 12:19684887-19684909 CCATTCAAGCAGAATATGGATGG + Intronic
1094253239 12:28391054-28391076 CTTTTTAAGGAGAAGATGTGTGG + Intronic
1094358070 12:29600069-29600091 CTTGTCAAGGTCAGGATGGAAGG + Intronic
1095199804 12:39370226-39370248 CTTGCCAAAGAGAAGATTGAAGG - Exonic
1096793669 12:54060733-54060755 ATTTTCCACGAAAAGATGGAAGG - Intergenic
1097098858 12:56571847-56571869 CTTTGCAAGGTGAGGATGGCAGG + Exonic
1097816152 12:64076001-64076023 ATTTTCTAGGACAAGATGCATGG + Intronic
1097979016 12:65717877-65717899 TTTTTCAAGGATAATTTGGAAGG - Intergenic
1098200416 12:68048890-68048912 GTTATCAAGTAAAAGATGGAGGG + Intergenic
1099940870 12:89186776-89186798 CTTTTCAAAGTGAATATTGAGGG - Intergenic
1099997609 12:89796079-89796101 CTTTTCCAGAAGCAGATGAATGG - Intergenic
1101414682 12:104498894-104498916 CTTTTCCAGAAGAAGAAGAAAGG + Intronic
1102340388 12:112116835-112116857 GTTATCAAGGAGAAGAGGAAGGG - Intergenic
1102409419 12:112704397-112704419 CTTTTCAAGGTGCAGATCTATGG + Intronic
1102418640 12:112786531-112786553 CTCTTAAAGGAGAAGGAGGAGGG + Intronic
1102787163 12:115614386-115614408 GTGTCCAAGGAGTAGATGGAAGG + Intergenic
1103619776 12:122180051-122180073 TTTTTCAAGGAGGAAATGGTTGG + Intronic
1104326928 12:127808012-127808034 CCTTGCGAGGAGCAGATGGAAGG - Intergenic
1106245414 13:27945445-27945467 ATTTCCAAGGTGAAGATGTATGG + Exonic
1106248558 13:27967784-27967806 CATTTCAAGCAAAAGCTGGAAGG - Intronic
1107009258 13:35651841-35651863 CATTTCAATGGGAAGATGGTGGG - Exonic
1107398171 13:40040614-40040636 CTTTTGATGGTGAAGATGAAGGG - Intergenic
1107692057 13:42963080-42963102 CCTTTGAAGGATAAAATGGAAGG + Intronic
1107977314 13:45702905-45702927 GTTTTGAAGGAGGAGATGGGGGG - Intronic
1108340868 13:49496800-49496822 CTTTTTGAGGAGAGGATGGCTGG + Intronic
1109203164 13:59453240-59453262 ATTTTCAAGGAGAGCTTGGAAGG - Intergenic
1109456821 13:62603817-62603839 CTCTTCAGAGAGAAGCTGGAAGG + Intergenic
1110225388 13:73114211-73114233 CTTTTCAAGGCCAAGGTGGGTGG - Intergenic
1110468087 13:75826283-75826305 CTTTTGGAGGCCAAGATGGATGG - Intronic
1110875002 13:80498175-80498197 CTTTTCCAGAAGCAGCTGGATGG + Intergenic
1112170896 13:96970775-96970797 GGTTACAAGGAGAAGAGGGAGGG - Intergenic
1115334687 14:32233099-32233121 CTTTTCAGGGAGATGTAGGAAGG + Intergenic
1115505316 14:34088170-34088192 ATTAGTAAGGAGAAGATGGAAGG + Intronic
1115652214 14:35410795-35410817 CTTTTGAAAGTGAAGATGGGCGG - Intergenic
1117279762 14:54227526-54227548 ATTTTCAAGGAGGAGATTGGGGG - Intergenic
1117830045 14:59741186-59741208 CTGTTCCAGGAGCAGCTGGAAGG - Intronic
1118018862 14:61690177-61690199 CTTTTCAAGGCCAAAATGGAAGG - Intergenic
1118415339 14:65529474-65529496 CTTTGGAAGGCCAAGATGGATGG - Intronic
1119482755 14:74969217-74969239 TTTTTCAGAGAGAAGATGGCAGG - Intergenic
1120108348 14:80522543-80522565 TCTTTCAAGGGGAAGAAGGATGG + Intronic
1121002031 14:90458226-90458248 CTTTTCAAGCAAAAGGTGAAGGG + Intergenic
1121658245 14:95614406-95614428 CTTTTCAAGGATAGTATGGTGGG + Intergenic
1121856047 14:97271036-97271058 CTTTATAAAGAGAGGATGGATGG - Intergenic
1121887944 14:97561829-97561851 CCTTTCAAGGAGTAAATGGGTGG - Intergenic
1121891363 14:97594347-97594369 CTTTTCAGGGATAAGATGTGAGG - Intergenic
1124406162 15:29393929-29393951 TTTTTCCAGGGGAAAATGGAGGG - Intronic
1124486722 15:30123985-30124007 CTTTAGGAGGACAAGATGGAAGG - Intergenic
1124541800 15:30592962-30592984 CTTTAGGAGGACAAGATGGAAGG - Intergenic
1124756807 15:32414338-32414360 CTTTAGGAGGACAAGATGGAAGG + Intergenic
1127272629 15:57415010-57415032 CATTTCACGGAGCAGATGAATGG + Intronic
1127823930 15:62686632-62686654 CTGTTTCAGGAGAAGATGAAAGG + Exonic
1131006971 15:88986259-88986281 GGTTACAAGGAGAAGATGGTGGG + Intergenic
1131862556 15:96669803-96669825 CTTTTCAAGGAGAAACGGGCTGG + Intergenic
1131968240 15:97867755-97867777 CTTTTCAAGGAAGAGAGAGAAGG + Intergenic
1132211725 15:100028832-100028854 CTTTTCAAAAAGGAGAAGGAGGG - Intronic
1133624631 16:7559633-7559655 CTTTCCAAGGTGGATATGGAGGG + Intronic
1134690004 16:16184903-16184925 GTTTTTAGGGAGAAGATGCATGG - Intronic
1134834707 16:17351269-17351291 CTTTTGGAGGCCAAGATGGATGG + Intronic
1135058322 16:19249643-19249665 CTTTTCATGTGGAAGGTGGAAGG + Intronic
1135269140 16:21053864-21053886 TTTTTAAAGGAGGAGCTGGAAGG + Intronic
1135633367 16:24053673-24053695 CTTTCAAAGGAGATGAAGGAGGG + Intronic
1135867790 16:26120414-26120436 CAGTTCAAGGACAAGATAGAAGG + Intronic
1137757437 16:50913864-50913886 CTTTAAAATGAGAAGGTGGAGGG + Intergenic
1137960427 16:52876902-52876924 CTCTTCACAGAGGAGATGGAAGG + Intergenic
1138310358 16:56018360-56018382 TTTTTCAAAGAGAACATGCATGG + Intergenic
1138741032 16:59310396-59310418 CTTTTAAAGTGGAAAATGGAGGG + Intergenic
1138937810 16:61751366-61751388 TTTTTTAAGGAGAATATGGAAGG - Intronic
1140521500 16:75585757-75585779 TCTTTCAAGGAGAATTTGGAAGG + Intergenic
1140700946 16:77581077-77581099 CTGTCCAAGGAGAAGATGGCTGG + Intergenic
1140898425 16:79346588-79346610 ATTTTGAAGGTGATGATGGATGG + Intergenic
1141202742 16:81910399-81910421 CTGTTCTAGGAGCAGAGGGAAGG + Intronic
1142054890 16:87987478-87987500 CTTTGGAAGGCCAAGATGGAAGG + Intronic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1143951069 17:10632570-10632592 CGGCTCAAGAAGAAGATGGAGGG - Exonic
1144393040 17:14813849-14813871 CTTTTCAAGGGGCAGGTCGAGGG - Intergenic
1145262420 17:21362432-21362454 CAGATAAAGGAGAAGATGGATGG + Intergenic
1145989496 17:29070419-29070441 ATGTCCTAGGAGAAGATGGAAGG + Intergenic
1146314163 17:31794342-31794364 CTTTTCAAAGAGAATAAGGCTGG + Intergenic
1148915742 17:50976651-50976673 CTTTTAAAATAGAAGATAGATGG + Intronic
1149103482 17:52934240-52934262 TTTTTCAAGGTTAAAATGGAGGG + Intergenic
1149728546 17:58922143-58922165 TTTTTCAATGAGGAGAGGGAGGG + Intronic
1150282761 17:63938859-63938881 CTTCTGAAGGAAGAGATGGAAGG + Exonic
1150409755 17:64933746-64933768 CTTTGGAAGGCAAAGATGGATGG + Intergenic
1151099356 17:71538984-71539006 ATTTTTAAGGAGGAGATGGAGGG - Intergenic
1151186626 17:72369503-72369525 TTTTTCCAGGAGGAGCTGGAAGG + Intergenic
1151518298 17:74611596-74611618 TTTTTCAAAGACAGGATGGAGGG - Exonic
1152732415 17:81978758-81978780 CTTTTTATGGAGAAGAGGGGCGG + Intronic
1153268344 18:3294522-3294544 CTCTTACAGGAGAAGAGGGAAGG + Intergenic
1153967860 18:10197774-10197796 TTTTTCTAGAAGAAGGTGGAGGG + Intergenic
1155547878 18:26933541-26933563 CATTTCAAGGGGAAAATGAATGG - Intronic
1156179347 18:34584798-34584820 GTTTTCAGAGAGAAGAAGGAGGG + Intronic
1158613628 18:58966130-58966152 CTACTCAAGGAGAAGAGAGAGGG - Intronic
1158621686 18:59038123-59038145 CTTATTAAGGAGAAGAAAGAAGG + Intergenic
1159258413 18:65978318-65978340 TTTGTCATGGAGAAGGTGGAGGG - Intergenic
1159346003 18:67205047-67205069 ATTTTAAAGGATAAAATGGAAGG - Intergenic
1160631531 18:80249774-80249796 CTTTTAAAGGAAAGGCTGGAAGG + Intergenic
1164794771 19:31016907-31016929 ATTTCCAAGGAGAAGCTGGCTGG - Intergenic
1164817871 19:31220043-31220065 CTTGTCAAGGCCAAGGTGGATGG + Intergenic
1164882943 19:31751143-31751165 CTTTTGAAGGCCAAGGTGGAAGG + Intergenic
1164911118 19:32012724-32012746 CTTTTCAAGGACAAGGAAGATGG - Intergenic
1165816378 19:38645006-38645028 CTTTCCCAGGAGAAGCTGGAGGG - Intergenic
1165957151 19:39508104-39508126 TTTTTCAAAGAGAAGATGGCAGG - Exonic
1166674073 19:44728607-44728629 CTTTGCAAGGGCAAGGTGGATGG - Intergenic
1167196829 19:48034919-48034941 CTTTGGAAGGACAAGGTGGAAGG - Intronic
1167751596 19:51383877-51383899 CTTTTCAATGGCAAGATGCAAGG - Intronic
1167883327 19:52480569-52480591 CTTTTCAAGGTGCAGATGTAAGG + Intronic
927441267 2:23119673-23119695 CTTGTGAAGGAGAAGCTGGCAGG - Intergenic
927583556 2:24278172-24278194 ATTTTAAAGGACAAGTTGGAGGG - Intronic
927626817 2:24730255-24730277 CTTTCCTAGGAGAGGAAGGATGG - Intronic
927853409 2:26513699-26513721 CCTTCCCAGGAGAGGATGGAGGG + Intronic
929000615 2:37344456-37344478 CTTCTCTTGGAGAAGATGAAAGG - Intergenic
931339568 2:61386216-61386238 CTTTTGGAGGCCAAGATGGAAGG + Intronic
932044834 2:68338003-68338025 CTTATCAAAGAGAGGAAGGAGGG - Intergenic
932885161 2:75542760-75542782 CCCTTCATGGAGAAGATGTAGGG + Intronic
932890489 2:75592109-75592131 CTGGTCAAGGAGAAGTTGCAAGG + Intergenic
933241593 2:79927521-79927543 TTTTTCAACAAGAAGATAGATGG + Intronic
933912395 2:86954069-86954091 GTTTTCAAGGAAAAGATAAAAGG + Intronic
933912741 2:86957719-86957741 ATTGTGAAGGTGAAGATGGATGG + Exonic
934010254 2:87812171-87812193 ATTGTGAAGGTGAAGATGGATGG - Exonic
934010600 2:87815828-87815850 GTTTTCAAGGAAAAGATAAAAGG - Intronic
934145394 2:89088645-89088667 CTTTTGGAGGCCAAGATGGACGG - Intergenic
934223864 2:90111899-90111921 CTTTTGGAGGTCAAGATGGATGG + Intergenic
935314461 2:101817677-101817699 CTTTCCATGGAGAAGAGGGCGGG + Intronic
935773818 2:106452891-106452913 ATTGTGAAGGTGAAGATGGATGG - Exonic
935906245 2:107843022-107843044 ATTGTGAAGGTGAAGATGGATGG + Exonic
935992712 2:108735545-108735567 ATTGTGAAGGTGAAGATGGATGG + Exonic
936128028 2:109808187-109808209 ATTGTGAAGGTGAAGATGGATGG + Exonic
936216669 2:110563298-110563320 ATTGTGAAGGTGAAGATGGATGG - Exonic
936425808 2:112417879-112417901 ATTGTGAAGGTGAAGATGGATGG - Exonic
937393404 2:121513439-121513461 TTTTTTAAAGAGAAGAAGGAGGG + Intronic
938251054 2:129816027-129816049 GTTTTTAAGGGGAATATGGAGGG + Intergenic
938982163 2:136537273-136537295 CTTTTAAAGAAGGAGTTGGAGGG - Intergenic
939595907 2:144121863-144121885 TTTTTAAAGGTGAAGATGAAGGG - Intronic
940479710 2:154212715-154212737 CCTTAGAAGGAGAAGAAGGATGG - Intronic
940761535 2:157743930-157743952 CTTTTGAAGGAAAGGAAGGATGG - Intronic
940866308 2:158820813-158820835 CTTTATAAGGAGAAGAAGGGAGG + Intronic
942771120 2:179521642-179521664 CTTTTTAGAGAGCAGATGGATGG - Intronic
943712934 2:191117940-191117962 CTGTTCAAGAGGAAGATAGATGG + Intronic
944502083 2:200372289-200372311 CTGTTCAAGCAGAAGCTGGCTGG - Intronic
945112936 2:206380698-206380720 CTTTTAAAGAAGACAATGGAAGG - Intergenic
945924255 2:215787753-215787775 CTGGCCACGGAGAAGATGGACGG + Intergenic
946835394 2:223767495-223767517 ATATTCAAGCAGAAGATGGATGG - Intronic
947314306 2:228838940-228838962 CTTTTCAAAGGGAAGATGGTTGG - Intergenic
947914430 2:233822373-233822395 CTTCTGAATGAGAAGGTGGATGG - Exonic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
948024966 2:234769469-234769491 CTTTTCAAGGCCAAGGTGGGAGG + Intergenic
948073884 2:235149964-235149986 CTTTGCAGGAAGAAGCTGGATGG + Intergenic
948372159 2:237496261-237496283 TTTTCCAAGGAGCAGAGGGAGGG + Intronic
948374376 2:237511854-237511876 CTTTTCAGGGAGAGGGTGGGAGG + Intronic
1171151251 20:22828122-22828144 CATTCCAAGGAGATGAGGGAGGG - Intergenic
1171405950 20:24912680-24912702 TTTTTCATGGAGAAGAATGAGGG + Intergenic
1171415717 20:24979299-24979321 TATTTCACAGAGAAGATGGAAGG + Intronic
1172447393 20:35000369-35000391 CGGCTCAAGAAGAAGATGGAGGG + Exonic
1173810571 20:45952725-45952747 AGGTTCTAGGAGAAGATGGAGGG + Intronic
1174241375 20:49138039-49138061 CTTTTTAAGGACAAGGTGGGTGG + Intronic
1174723771 20:52840200-52840222 CTTATCAAGGAGAAGAAGCGGGG + Intergenic
1175110620 20:56645540-56645562 TTTTTGAACTAGAAGATGGAAGG - Intergenic
1175348448 20:58300555-58300577 CCTTTCAAGAAGCAGCTGGAGGG - Intergenic
1175572977 20:60038097-60038119 TTTATCAAAGAAAAGATGGATGG - Intergenic
1175825607 20:61934879-61934901 CTTGCAAAGGGGAAGATGGAAGG - Intronic
1176926239 21:14752833-14752855 CTCTCCCAGGAGAAGATGGTTGG - Intergenic
1179418268 21:41215566-41215588 GTTTTCCAGCAGAAGCTGGATGG - Intronic
1180938122 22:19639314-19639336 CTTTTCAAGGCCGAGATGGGAGG - Intergenic
1181609791 22:24004705-24004727 CTTTTCGAGGAGAAGGGGGAAGG - Intergenic
1181979972 22:26759474-26759496 CTTTTCAAGGGGGAGGTGTATGG - Intergenic
1183002417 22:34872424-34872446 GTGTTCAAGGAGAGGCTGGATGG - Intergenic
1184625239 22:45722273-45722295 ATTTTCAAGGAAGAGATAGAGGG + Intronic
949104024 3:181834-181856 CTTATCAAGGAGATGAGGGAAGG - Intergenic
949855926 3:8461050-8461072 CTTTTCAGTGGGAAAATGGAAGG + Intergenic
950342334 3:12258386-12258408 GTATTCAAGGAGCAGGTGGATGG + Intergenic
950752862 3:15144732-15144754 CTCTTCATGGAGACGATGCAAGG - Intergenic
951280625 3:20744738-20744760 ATTGTAAAGGAGAGGATGGAGGG - Intergenic
952594413 3:34998773-34998795 ATTTACATGCAGAAGATGGAAGG - Intergenic
953394344 3:42555431-42555453 CTTTTCAAGGCCAAGGTGGGAGG - Intronic
953639474 3:44692919-44692941 CTTTTGGAGGCCAAGATGGATGG + Intergenic
955691549 3:61595583-61595605 CTTTTCAATTAGGAGAAGGAAGG - Intronic
955763411 3:62314633-62314655 AATTTCAAGGAGGGGATGGAAGG - Intergenic
955819325 3:62879438-62879460 ATTTACATGGACAAGATGGAGGG + Intergenic
956012095 3:64842801-64842823 CTTTAGAAGGAAAAGGTGGAAGG + Intergenic
958095075 3:88933918-88933940 CTTTCCAGGGAGAACATGGCAGG - Intergenic
958981780 3:100728925-100728947 CTTTTTAAGTAGGAGAAGGATGG + Intronic
960279705 3:115767508-115767530 CTTTTGAAGGAGAAAGTGAAAGG + Intergenic
961032628 3:123619609-123619631 GTTTTCACTGAGGAGATGGACGG + Intronic
961285408 3:125798452-125798474 CTCTTCAGGGAGATGATGCAAGG - Intergenic
963967572 3:151389839-151389861 TTTATAAAGGAGAAGATGGAAGG - Intronic
964427822 3:156571674-156571696 CTTTCCAAGGAGAATATGGTGGG - Intergenic
964464336 3:156973633-156973655 CTTTTCAAGGTGATGAATGATGG - Intronic
964690195 3:159441809-159441831 CCATTCAAGGACAAGATGAAAGG - Intronic
966249301 3:177844805-177844827 CTGCTCAAGGAAAAGAGGGAAGG + Intergenic
966274664 3:178150950-178150972 CTTTTCAAGGAGAATTTTCAAGG + Intergenic
966449797 3:180045236-180045258 CACTTGAAGGAGAAGAAGGAAGG - Intergenic
966458076 3:180141002-180141024 AGTTGAAAGGAGAAGATGGAGGG - Intergenic
966569212 3:181422177-181422199 CTTTTATGGGGGAAGATGGAGGG - Intergenic
966902467 3:184496756-184496778 GTTTTCAAGTTGAAGAAGGAAGG + Intronic
967231045 3:187337749-187337771 CTGATCATGGAGCAGATGGATGG - Intergenic
967758932 3:193202286-193202308 CCTGGGAAGGAGAAGATGGAAGG + Intergenic
968268680 3:197382671-197382693 CACATCAAGGAGAAGATGGAAGG - Intergenic
970018568 4:11540484-11540506 CTCTTCAAGGAGAAGATAGGAGG + Intergenic
970227136 4:13870893-13870915 CTTGTCAAAGAGAAGAATGAAGG - Intergenic
971028351 4:22610268-22610290 CATTTCAAGGGGAAAATGAATGG - Intergenic
972722101 4:41710292-41710314 CTTTTCAAGGAGTAATAGGATGG - Intergenic
972766902 4:42159634-42159656 CATTCCAAAGAGAGGATGGAGGG - Intergenic
974106791 4:57478652-57478674 TTTTTCAGTGGGAAGATGGATGG - Intergenic
974453444 4:62095414-62095436 GTTTTCAAGGAGAGGCAGGAGGG + Intergenic
975664245 4:76719102-76719124 CTTTTTAGGGAGAAGATGTCTGG - Intronic
975850987 4:78572494-78572516 TTTTTCAAGGTTAAAATGGAGGG + Intronic
976151715 4:82099154-82099176 CTCTCCAAGAAGAAGGTGGAGGG - Intergenic
976782610 4:88777769-88777791 CATTTTCAGGAGAAGATGGTAGG - Intronic
976886681 4:89993482-89993504 CTTTTAATGGAAAAAATGGAAGG + Intergenic
976953621 4:90866196-90866218 ATTGTCAAGGAGAAGAGAGAGGG - Intronic
976954150 4:90874077-90874099 CTTTTTAAATTGAAGATGGAAGG - Intronic
977234510 4:94492050-94492072 CTTTTAAAGGAGGACATTGAGGG - Intronic
977293724 4:95190642-95190664 CTTTGCAAGGAAAAGTTAGAGGG - Intronic
977397315 4:96486770-96486792 CTGTTCAGGGAGGGGATGGAAGG + Intergenic
977914531 4:102577001-102577023 ATTTGCAAGCAGAAGGTGGAGGG + Exonic
978141751 4:105325749-105325771 CCTTTCAAGGACAATATGCAGGG - Intergenic
978436027 4:108685311-108685333 CTTCTCAAGGAGAAGAATTAGGG - Intergenic
978791156 4:112664823-112664845 CTTTACAAGGCCAAGATGGGAGG + Intergenic
979006091 4:115299004-115299026 CTTTTGAAGGCCAAGGTGGAAGG - Intergenic
979309358 4:119184056-119184078 CTTTGGGAGGAGAAGGTGGATGG - Intronic
979838728 4:125408618-125408640 CTGTTCGAGCAGAAGATGGTGGG + Exonic
979884831 4:126013893-126013915 GTTTTCAGTTAGAAGATGGAGGG - Intergenic
980061426 4:128134242-128134264 CTTTGCAAGGCCAAGATGGAAGG - Intronic
981574564 4:146191186-146191208 TCTTTTAAGGAGAAAATGGATGG + Intronic
981660119 4:147157158-147157180 GTTTACAAGGGCAAGATGGATGG + Intergenic
982585839 4:157237521-157237543 CTTTGGAAGGCCAAGATGGAAGG - Intronic
983515480 4:168651706-168651728 CTTTACAAGAAGAAGAGGTAGGG + Intronic
983566635 4:169159914-169159936 CTGTTCAACCAGAAGATGAATGG - Intronic
984364833 4:178785135-178785157 CTTTTGAAGAAGAAGTAGGAAGG - Intergenic
984578889 4:181487162-181487184 ATTTTCAACTAGAAGATAGAGGG + Intergenic
986291997 5:6407589-6407611 CTCTGGAAGGAGAAGAGGGAAGG - Intergenic
987652793 5:20765661-20765683 CTTTTCAAAGCGAAAATGGAAGG - Intergenic
987676083 5:21074084-21074106 CTTTTGAATAAGAAGATGAATGG - Intergenic
988742764 5:34095823-34095845 CTTTTCAAAGCGAAAATGGAAGG + Intronic
989098043 5:37798999-37799021 TTTTTAACAGAGAAGATGGAGGG + Intergenic
989733780 5:44678965-44678987 CTTTTGAAGGAAAACATTGAGGG + Intergenic
989780011 5:45253695-45253717 CTTTTCATGGAGAAGCTTGCTGG + Intergenic
990278560 5:54225857-54225879 TTTTTCAATGAGAAGGTAGATGG - Intronic
990650977 5:57899196-57899218 CCTTTCAAGGAAATGATGAATGG + Intergenic
991341627 5:65616963-65616985 CTTTGCAAGGCTAAGATGGGTGG - Intronic
992205043 5:74423028-74423050 CTCTTCTAGGAGAAAATGGATGG - Intergenic
992830878 5:80592439-80592461 TTTTTCATAGAGAAGATAGAAGG + Intergenic
995641903 5:114266828-114266850 CTTTACAAGGAGATGCTGGTGGG - Intergenic
996620269 5:125493077-125493099 CTTTTGAAGGAAAATCTGGAAGG - Intergenic
997199871 5:132003451-132003473 CTTTTCAAGGCCAGGATGAATGG + Intronic
997303416 5:132822796-132822818 CTATGTAAGGAGAAGAGGGAAGG + Exonic
998491479 5:142550944-142550966 CTTTGGAAGGATAAGGTGGACGG - Intergenic
999086727 5:148898700-148898722 TTTCTCAAAGAGAAGAGGGAAGG - Intergenic
999487121 5:152008032-152008054 CTTGTCAACTACAAGATGGATGG + Intergenic
1001164683 5:169353030-169353052 TTTTTCAAAGAGGAGAAGGAAGG - Intergenic
1002178587 5:177417340-177417362 CTGTTCAAGGAGACGTTGGGGGG + Intronic
1003949059 6:11101495-11101517 CTTCCGAAGGAGGAGATGGAAGG + Intronic
1004485073 6:16058704-16058726 GTTTTTAAGGGAAAGATGGAGGG - Intergenic
1005368417 6:25103456-25103478 CTTTTCAACCAGAAGATGAAGGG - Intergenic
1006559919 6:34902185-34902207 CTTTTCAAGTAGATGATCCAGGG + Intronic
1007194090 6:40044974-40044996 CTGTTCAGGGAGCAGAGGGAGGG + Intergenic
1008449317 6:51631886-51631908 CTTTTAAAGGAGAAGAGGAGAGG + Intronic
1010740478 6:79497014-79497036 CATTTCATGAAGAATATGGATGG - Intronic
1010804496 6:80219121-80219143 TTTTTCAAAGAGAAAATGAAAGG - Intronic
1011401972 6:86973158-86973180 ATTTAAAAGGAGAAGGTGGAGGG - Intronic
1011478113 6:87767527-87767549 TTTCTAAAGGAGAAGCTGGAGGG + Intergenic
1011528442 6:88292897-88292919 CCTTTTAAGGATAAGAAGGAAGG - Intergenic
1011791506 6:90903925-90903947 GTTTTCAAGACTAAGATGGAAGG + Intergenic
1012914726 6:105157192-105157214 CTGTTCCAGGAGCAGCTGGAAGG - Intergenic
1013929023 6:115507619-115507641 CTGTTAAAGGAAATGATGGAGGG - Intergenic
1014272077 6:119347641-119347663 ATTTTCAAGATGAAGATCGAAGG - Intronic
1014640323 6:123900950-123900972 ATTTTCTTTGAGAAGATGGAAGG + Intronic
1016877893 6:148881713-148881735 CTTGTCAAGGAGTCGATGGTGGG - Intronic
1017593063 6:155997624-155997646 TTTTGCAGGCAGAAGATGGAAGG + Intergenic
1017858516 6:158373600-158373622 CTTTTCAAGGAGAAGACATTTGG + Intronic
1019754948 7:2762198-2762220 CGTTTCTAGGAGAAGTTGTAAGG + Intronic
1020434004 7:8142655-8142677 CTTGTCATGTAAAAGATGGAAGG - Intronic
1021441710 7:20684933-20684955 CTTTCCCAGGAGGAGATGGGAGG - Intronic
1021856821 7:24865211-24865233 CTTTACAAGCAAAATATGGAAGG + Intronic
1021927006 7:25543531-25543553 CTTTGCAGGAGGAAGATGGAAGG - Intergenic
1022037248 7:26546130-26546152 CCTTTCAGCCAGAAGATGGAAGG - Intergenic
1022041034 7:26581627-26581649 CTTCTCAAGGAGAACATCAAAGG + Intergenic
1022585583 7:31605527-31605549 CTTTTCAGGGACATGTTGGAAGG + Intronic
1022802778 7:33791937-33791959 CTCTTCCAGGAGGAGATGTATGG - Intergenic
1023046002 7:36210670-36210692 GTTTTCTAGGAGGAGAGGGAAGG - Intronic
1023532915 7:41176996-41177018 CTTTTGGAGGAGGAGAAGGAGGG + Intergenic
1024872943 7:53987082-53987104 CTTTTAAGGGAATAGATGGAAGG - Intergenic
1024963410 7:55002094-55002116 CTTATCAAGGAAAAGATTCATGG - Intergenic
1026249303 7:68654230-68654252 CTTTTGAAGGCTAAGATGGGAGG + Intergenic
1026279244 7:68906833-68906855 TCTTTCAAGGGGAAAATGGATGG - Intergenic
1026528077 7:71173140-71173162 CTGTTCCAGGAGAACCTGGAGGG + Intronic
1032155377 7:129463469-129463491 TTTTCAAAGGGGAAGATGGAAGG - Intronic
1032364305 7:131285052-131285074 CTTTTCCAGCAGAAGCTGCAGGG + Intronic
1033180561 7:139173609-139173631 CTTTTTAAGGAGATGGTGGATGG - Intronic
1034649863 7:152681561-152681583 CTTTGCGAGGTCAAGATGGAAGG - Intergenic
1034746018 7:153524512-153524534 CTCTCCAAGGAGGAGGTGGAGGG + Intergenic
1034997392 7:155586866-155586888 CTTTTCAAGCACAAGCTAGAAGG - Intergenic
1035160121 7:156944063-156944085 GTTTTCAGTGAGAAGATGCAGGG + Intergenic
1035398228 7:158548931-158548953 CTTGCCAAGGAGGAGATGGGTGG - Intronic
1035773017 8:2164643-2164665 CTTTGCACAGTGAAGATGGATGG - Intronic
1036541716 8:9720473-9720495 CCTTGTAAGGAGATGATGGAGGG - Exonic
1037216950 8:16466320-16466342 ATTTTCATGGAGAAGATAGATGG - Intronic
1037635409 8:20697530-20697552 CTTTTCAAGGAGGAGAAGGCTGG - Intergenic
1037908468 8:22729173-22729195 CTCTTCCAGGAGAGGAGGGAAGG + Intronic
1038060513 8:23907257-23907279 CTCTTCAAGGGGAAGGTAGAAGG - Intergenic
1038427456 8:27473454-27473476 CTTTTGGAGGCCAAGATGGAAGG + Intronic
1038736225 8:30172117-30172139 CTTTTAAAGGAGAAACTGTAAGG - Intronic
1039776000 8:40737329-40737351 CGATTTAAGGAGAAGAGGGATGG + Intronic
1042227877 8:66528849-66528871 CTTTTCAAGGACAGCATGCAGGG - Intergenic
1043050705 8:75381887-75381909 TTTTTCTAGAAGAAGAAGGATGG - Intergenic
1043132144 8:76474574-76474596 CTTGTGAAGGTGAAGATGGCTGG + Intergenic
1043305179 8:78784871-78784893 CTTTTCAAGGAGAAGATGGAGGG - Intronic
1043671468 8:82890400-82890422 CTTAAAAAGAAGAAGATGGAGGG - Intergenic
1043990017 8:86741418-86741440 CTTTGCAAGGACAAGGTGGGCGG + Intronic
1044325404 8:90852586-90852608 CTTTACAGGCAGAGGATGGAGGG - Intronic
1044632352 8:94292001-94292023 CTTTTCATTGAGAAGTTGGCTGG - Intergenic
1044807355 8:96021675-96021697 CTTTTCAGGTGCAAGATGGATGG + Intergenic
1045068317 8:98473484-98473506 TTTCTAAAGGAGAAGAGGGATGG - Intronic
1045071597 8:98511667-98511689 CATTTCCAGGAGAAAGTGGATGG - Intronic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1045343882 8:101277342-101277364 CTTTGGAAGGCCAAGATGGAAGG - Intergenic
1045920407 8:107522270-107522292 CTGTTCAGGGAGAGGGTGGAAGG + Intergenic
1046117791 8:109804907-109804929 CTTTTCAAGGACAATGGGGAAGG + Intergenic
1046366620 8:113240155-113240177 CTTTGAAAGGAGGACATGGATGG - Intronic
1046914028 8:119660453-119660475 CTTTTCAAAGACAAGACAGATGG - Intronic
1047171967 8:122502508-122502530 AGTTTCAAGGTGGAGATGGAGGG + Intergenic
1047497883 8:125421453-125421475 CTTAGCAGGGAGAAGAAGGAAGG - Intergenic
1047624884 8:126646561-126646583 CATGTTAAGTAGAAGATGGACGG + Intergenic
1047793255 8:128227247-128227269 ATCTTCAAAGAGAAGATGAAAGG + Intergenic
1048174043 8:132135436-132135458 GTTTCCAAGGAGGAGACGGAAGG - Intronic
1048195804 8:132330921-132330943 CTGATCATGGAGAAGATGTAGGG - Intronic
1049274479 8:141712957-141712979 CTTTTCAGAGGGAGGATGGAAGG + Intergenic
1050073411 9:1839850-1839872 CTTTTCATAGGGAAGATGAAGGG - Intergenic
1050158753 9:2695279-2695301 CATTTCAAGCAGAAGAGGCAAGG - Intergenic
1050609594 9:7337640-7337662 TTTTTAAAGGAGAAGGTAGATGG + Intergenic
1050877635 9:10659532-10659554 CCTGTCAAAAAGAAGATGGATGG - Intergenic
1051372668 9:16371625-16371647 CTTTTCAAGGAGAAGCCCAAGGG + Intergenic
1051851461 9:21514098-21514120 CTTTTGAAGGCCAAGGTGGAAGG + Intergenic
1052240162 9:26261957-26261979 GTTTTTAAGGAGATCATGGAGGG + Intergenic
1053174650 9:35913094-35913116 CTACTCCAGGAGTAGATGGATGG - Intergenic
1053217191 9:36281883-36281905 TTTTTCCAGGATAAGATGGTTGG + Intronic
1055467807 9:76582812-76582834 CTTTTCAAAGAGAAAATGCCTGG + Intergenic
1056316694 9:85397153-85397175 TCTCTCAAGGAGAAAATGGACGG + Intergenic
1056486297 9:87061561-87061583 ATTTTAAAGGAGAAGGTGAAAGG - Intergenic
1057272212 9:93657661-93657683 CTCTTCAATGGGAAGAGGGAGGG + Intronic
1057303290 9:93898748-93898770 CTCTTCTAGGGGAAGAAGGAGGG + Intergenic
1057920618 9:99093739-99093761 CTTTTCAAGCAGCAGAGGTATGG - Intergenic
1058555598 9:106163459-106163481 CTTTTTAAGTAGAAGAGGGAGGG + Intergenic
1059275431 9:113092702-113092724 CTTTTAAAGGACAAGGTGGGTGG + Intergenic
1060401665 9:123353246-123353268 CTTTCCAGGAAGCAGATGGAAGG + Intergenic
1060547910 9:124471437-124471459 TTCTTCAAGGAAAAGATGGAGGG - Intronic
1060677487 9:125528542-125528564 CTTTTCAGTTAGAAAATGGAAGG + Intronic
1060691628 9:125666304-125666326 CTTTTCATAGAGGAGATAGAGGG - Intronic
1062222357 9:135423835-135423857 TTTTTCAAGGAGAATTTGGTGGG - Intergenic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1187069778 X:15877139-15877161 ATATTCATGGAGAAGTTGGAAGG + Intergenic
1187546423 X:20257202-20257224 CTTTCCCAAGTGAAGATGGAAGG - Intronic
1188440822 X:30214292-30214314 ATTTGCAAGGAGATCATGGAGGG + Intergenic
1188495734 X:30781236-30781258 GATGTCAGGGAGAAGATGGAAGG - Intergenic
1191889195 X:65923782-65923804 ATTTTCAAGGAGGAAATGAAAGG - Intergenic
1192442523 X:71185230-71185252 CTGTTGAAAGAGTAGATGGAAGG - Intergenic
1196974706 X:121146534-121146556 TTTTCCAAGGAGAACATAGAAGG + Intergenic
1200270715 X:154680039-154680061 CTTTCTAAGGAGAATATGCATGG + Intronic