ID: 1043305436

View in Genome Browser
Species Human (GRCh38)
Location 8:78787736-78787758
Sequence TCCACGGCCTCTCTTCAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043305429_1043305436 10 Left 1043305429 8:78787703-78787725 CCCCAATTCACTTGCTTTTCCCC 0: 1
1: 0
2: 2
3: 20
4: 294
Right 1043305436 8:78787736-78787758 TCCACGGCCTCTCTTCAAAGTGG No data
1043305434_1043305436 -10 Left 1043305434 8:78787723-78787745 CCCAGTAGACATTTCCACGGCCT 0: 1
1: 0
2: 0
3: 8
4: 67
Right 1043305436 8:78787736-78787758 TCCACGGCCTCTCTTCAAAGTGG No data
1043305431_1043305436 8 Left 1043305431 8:78787705-78787727 CCAATTCACTTGCTTTTCCCCAG 0: 1
1: 0
2: 2
3: 32
4: 349
Right 1043305436 8:78787736-78787758 TCCACGGCCTCTCTTCAAAGTGG No data
1043305430_1043305436 9 Left 1043305430 8:78787704-78787726 CCCAATTCACTTGCTTTTCCCCA 0: 1
1: 0
2: 4
3: 40
4: 408
Right 1043305436 8:78787736-78787758 TCCACGGCCTCTCTTCAAAGTGG No data
1043305428_1043305436 29 Left 1043305428 8:78787684-78787706 CCATATTTAGGGGTCATTTCCCC 0: 1
1: 0
2: 1
3: 7
4: 98
Right 1043305436 8:78787736-78787758 TCCACGGCCTCTCTTCAAAGTGG No data
1043305433_1043305436 -9 Left 1043305433 8:78787722-78787744 CCCCAGTAGACATTTCCACGGCC 0: 1
1: 1
2: 0
3: 7
4: 95
Right 1043305436 8:78787736-78787758 TCCACGGCCTCTCTTCAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043305436 Original CRISPR TCCACGGCCTCTCTTCAAAG TGG Intronic
No off target data available for this crispr