ID: 1043305926

View in Genome Browser
Species Human (GRCh38)
Location 8:78795070-78795092
Sequence ACAGAAGAATCTGAGGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 634
Summary {0: 1, 1: 0, 2: 4, 3: 74, 4: 555}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043305926_1043305931 13 Left 1043305926 8:78795070-78795092 CCCTGGGCCTCAGATTCTTCTGT 0: 1
1: 0
2: 4
3: 74
4: 555
Right 1043305931 8:78795106-78795128 TAGTAAGAGTGTCTTTCTCAAGG No data
1043305926_1043305932 14 Left 1043305926 8:78795070-78795092 CCCTGGGCCTCAGATTCTTCTGT 0: 1
1: 0
2: 4
3: 74
4: 555
Right 1043305932 8:78795107-78795129 AGTAAGAGTGTCTTTCTCAAGGG No data
1043305926_1043305933 25 Left 1043305926 8:78795070-78795092 CCCTGGGCCTCAGATTCTTCTGT 0: 1
1: 0
2: 4
3: 74
4: 555
Right 1043305933 8:78795118-78795140 CTTTCTCAAGGGCTGTTGTAAGG No data
1043305926_1043305930 -10 Left 1043305926 8:78795070-78795092 CCCTGGGCCTCAGATTCTTCTGT 0: 1
1: 0
2: 4
3: 74
4: 555
Right 1043305930 8:78795083-78795105 ATTCTTCTGTTGTGAAACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043305926 Original CRISPR ACAGAAGAATCTGAGGCCCA GGG (reversed) Intronic
901368543 1:8775862-8775884 ATCGAGGAAGCTGAGGCCCAGGG + Intronic
901688020 1:10955077-10955099 TCGGAGGAATCTGAGGCTCAGGG + Exonic
901784621 1:11616619-11616641 AGAGAGGAAACTGAGGCACAGGG + Intergenic
902399023 1:16147451-16147473 AAAGAGGAGTTTGAGGCCCAGGG + Intronic
902631522 1:17707371-17707393 GAAGAGGAAACTGAGGCCCAGGG - Intergenic
903382399 1:22906301-22906323 AAAGAGGAAACTGAGGCACAGGG + Intronic
903470082 1:23580739-23580761 AAGGAAGAAACTGAGGCTCAGGG - Intergenic
903605125 1:24569925-24569947 AGTGAGGAAACTGAGGCCCAAGG - Intronic
904081947 1:27877759-27877781 GAAGAGGAAACTGAGGCCCAGGG - Intronic
904093484 1:27960576-27960598 GGCGAAGAAACTGAGGCCCAGGG + Intronic
904274102 1:29369265-29369287 GAAGAAGAAACTGAGGCTCAGGG + Intergenic
904302248 1:29561825-29561847 TCAGAGGAAACTGAGGCTCAGGG + Intergenic
904356056 1:29940691-29940713 ACTGAAGAAGCTGAATCCCAGGG + Intergenic
904364381 1:30001234-30001256 TGAGAAGAAACTGAGGCTCAGGG + Intergenic
904392404 1:30194748-30194770 ACAGCAGATGCAGAGGCCCAAGG + Intergenic
904550782 1:31315644-31315666 AATGAAGAATTTGAGGCTCAGGG - Intronic
904763708 1:32824716-32824738 ACAGAAAAATCAGCGGCGCATGG - Intronic
905675672 1:39823253-39823275 AAAGATGAAACTGAGGCACAGGG + Intergenic
905852271 1:41283074-41283096 ACAGCAGAATCTGGTGGCCAGGG - Intergenic
905917667 1:41697054-41697076 ACAGAAGAGACGGAGGCCCCAGG + Intronic
906082254 1:43101093-43101115 CCAGAAGCCTCTGTGGCCCATGG + Intergenic
906244022 1:44260636-44260658 AGTGAAGAAACTGAGACCCAGGG - Intronic
906282516 1:44564070-44564092 ACAGAAGAAACTGGGGCCATTGG - Intronic
907159666 1:52360932-52360954 ACAGGAGCATCAGAGGCACAGGG + Intronic
907982170 1:59494386-59494408 ACAGCAGGAGCAGAGGCCCAGGG + Intronic
908005925 1:59729549-59729571 ATAGAAGAATGTGAGGCCTCTGG - Intronic
908830676 1:68175306-68175328 AGTGAGGAAACTGAGGCCCATGG + Intronic
910061214 1:83094955-83094977 AAAGAAGAAACTGAGGTCGAAGG - Intergenic
910675953 1:89817028-89817050 AAAGAAGAATCTGAGCTCCTTGG - Intronic
911226029 1:95306697-95306719 AGAGAGGAAACTGAGGCCCATGG - Intergenic
912504954 1:110150217-110150239 AAAGAAGAAAGTGAGGCCCAGGG + Intergenic
912516391 1:110219111-110219133 GATGAAGAAACTGAGGCCCAGGG - Intronic
913074026 1:115325997-115326019 ATATAAGAGTCTGGGGCCCAGGG + Intronic
913185875 1:116370667-116370689 GATGAAGAAACTGAGGCCCAGGG - Intergenic
913317688 1:117566398-117566420 GCTGAAGAATCTGAGACTCAGGG + Intergenic
913421445 1:118674196-118674218 ACAGAAGAATTTGAGGCAGTTGG - Intergenic
913699747 1:121362754-121362776 ACTGAAGCAACAGAGGCCCAAGG - Intronic
914137794 1:144917282-144917304 ACTGAAGCAACAGAGGCCCAAGG + Intronic
915557830 1:156670070-156670092 TCAGAAGAATTTGAGGACCTGGG - Exonic
915608305 1:156969384-156969406 ACAGAAGGAGCTGTGGCCTAGGG + Intronic
915846034 1:159266193-159266215 AATGAAGAAACTGAGGCTCATGG + Intergenic
915997558 1:160579263-160579285 ACAGTAGATACTGAGACCCAGGG + Intronic
916310979 1:163398573-163398595 ACCCAAGTAACTGAGGCCCAGGG - Intergenic
916523307 1:165585478-165585500 ACAGGAGAATCTGGGGCCAAAGG - Intergenic
917123373 1:171664212-171664234 ACAGAAGAGTGTGAGTGCCAGGG - Intergenic
918104622 1:181405874-181405896 TAGGAAGACTCTGAGGCCCAGGG + Intergenic
919063080 1:192659103-192659125 AAAGAAAAATATGAGGCTCAAGG - Intronic
919458083 1:197843655-197843677 AAAGAGGAAACTGAGGCACAGGG - Intergenic
920487160 1:206381463-206381485 ACTGAAGCAACAGAGGCCCAAGG - Intronic
920675713 1:208037359-208037381 ACAGAGGAAGCTGTGGCACAGGG - Intronic
921555046 1:216588294-216588316 ACAGAAGAATCAGTAGCCCAAGG - Intronic
921624697 1:217366031-217366053 ATGGTAGAATCTCAGGCCCATGG + Intergenic
921908001 1:220515431-220515453 AATGAAGAAACTGAGGCACAGGG + Intergenic
922508246 1:226139972-226139994 CCTGAAGAATCTGAGGAGCAGGG + Intergenic
922574066 1:226650821-226650843 ACACAGGAAACTGAGGCCCCAGG - Intronic
922725429 1:227920834-227920856 AGGGAGGAAGCTGAGGCCCAGGG + Exonic
923251417 1:232182330-232182352 ACAGCAGAAGCTGAAGCCCTCGG - Intergenic
1063193965 10:3722860-3722882 AATGAAGAATCAAAGGCCCAGGG + Intergenic
1063299236 10:4836696-4836718 ACAGAAAGAGTTGAGGCCCATGG - Intronic
1063721731 10:8589358-8589380 AATGGAGAAACTGAGGCCCAGGG - Intergenic
1063802190 10:9592779-9592801 ACAGAGGAAACTGAGGCCTCTGG + Intergenic
1063897764 10:10700274-10700296 AAAGAAGAAAGGGAGGCCCAAGG + Intergenic
1065145133 10:22761183-22761205 ACAAAGGAAACTGAGGCGCAGGG + Intergenic
1065187486 10:23183116-23183138 CCAGAAAAATCAGAGGCCCATGG + Intergenic
1065974636 10:30831403-30831425 GCACAAGAATCTGAGGCTGATGG - Intronic
1066180398 10:32957018-32957040 AGTGAAGAAACTGAGGCACAGGG - Intronic
1066236447 10:33489620-33489642 ACAGAAGAGTCAGAGACCAAAGG + Intergenic
1067781190 10:49208704-49208726 GATGAAGAAACTGAGGCCCAAGG - Intergenic
1067825701 10:49571169-49571191 ACAAAGGAATCTGAGGCCTTTGG + Intergenic
1068648973 10:59500471-59500493 ACAGAATAATCAGAAGCACAAGG - Intergenic
1068653410 10:59549009-59549031 AAAGAGGAAACTGAGGCCCAGGG - Intergenic
1069596427 10:69674778-69674800 ACAGAAGTATATGATGCCCAGGG - Intergenic
1069753285 10:70758404-70758426 ACTGAGGTATCTGAGGCTCAGGG - Intronic
1069767380 10:70873126-70873148 AATGAGGAATCTGAGACCCAGGG - Intronic
1069807717 10:71136436-71136458 GAAGAGGAATCGGAGGCCCAGGG + Intergenic
1069861770 10:71475944-71475966 AGAGTGGAAACTGAGGCCCAGGG - Intronic
1070160322 10:73862941-73862963 ATGGAAGAAACGGAGGCCCAGGG + Intronic
1070380222 10:75874558-75874580 AATGAGGAAACTGAGGCCCAAGG + Intronic
1070517303 10:77220160-77220182 AATGAAGAAACTGAGGCACAGGG + Intronic
1070523730 10:77276937-77276959 GCTGAGGAAACTGAGGCCCAGGG + Intronic
1070561542 10:77571186-77571208 ACAGAAGAATCAGATTCCCGAGG - Intronic
1070751836 10:78968477-78968499 GATGAAGAAACTGAGGCCCAGGG + Intergenic
1070900852 10:80027888-80027910 ACAGGAGAAGCTGAGTCTCATGG - Intergenic
1071161816 10:82755563-82755585 AGGGAAGAATCTGAGTCCCCTGG + Intronic
1071293406 10:84202955-84202977 GCAGAAGAATCGGAGGCCACAGG - Intronic
1072747333 10:97950027-97950049 ACAGAAGACTGTGAGCTCCATGG + Intronic
1073057104 10:100709938-100709960 AGGGAAGAAACTGAGGCCCAGGG + Intergenic
1073207916 10:101778444-101778466 CCAGAAGATTCTGAGGGCCCTGG + Intronic
1073402890 10:103273545-103273567 ACAGAAGAAAGTGAGGCAAAAGG - Intergenic
1073622336 10:105062331-105062353 AATGAAGAAACTGAGGCCCTGGG - Intronic
1073973018 10:109066299-109066321 ACAGAATAAACTGCAGCCCAGGG - Intergenic
1075119775 10:119656187-119656209 ACAGAAGAAACTGAAGACAAAGG + Intronic
1075214670 10:120521705-120521727 ACAGCAGGAACTGAGGCACAGGG - Intronic
1076022776 10:127088135-127088157 AAAGAAAAATATGAGGCCCTTGG - Intronic
1076268841 10:129132882-129132904 CCAGGAGAAACTGAGACCCAGGG - Intergenic
1076411847 10:130257240-130257262 AGACAAGCAACTGAGGCCCAGGG + Intergenic
1076722392 10:132398446-132398468 CCAGAGGAAGCTGAGGCCGATGG - Intronic
1077003266 11:335991-336013 ACAGAAGACCCAGAGACCCAGGG - Intergenic
1077093213 11:788784-788806 AGAGAAGTGTCAGAGGCCCACGG - Intronic
1077285120 11:1762174-1762196 ACAGAAGCCTCTAAGGCCCCAGG - Intronic
1077746991 11:4917608-4917630 ACAGCAGAAGCTGAGGAGCACGG - Intronic
1077849669 11:6063268-6063290 ACAGAACAATCTTAGACCCCAGG + Intergenic
1078145651 11:8720351-8720373 ACATAGGATACTGAGGCCCAGGG + Intronic
1078844884 11:15111877-15111899 CATGAAGAAACTGAGGCCCAGGG - Intergenic
1079098870 11:17528413-17528435 ACAGCTGAAGCTGAAGCCCAAGG + Intronic
1079455011 11:20628870-20628892 GAAGAGGAAACTGAGGCCCAGGG - Intronic
1080054865 11:27896034-27896056 ACTGAATAAATTGAGGCCCATGG - Intergenic
1081198467 11:40189463-40189485 GTTGAAGAAACTGAGGCCCACGG - Intronic
1081715699 11:45248603-45248625 AGTGAAGGAACTGAGGCCCAGGG + Intronic
1081899813 11:46618011-46618033 ACAGAAAACTCAGGGGCCCAGGG - Intronic
1082881389 11:58041421-58041443 GCAGAGGAAGCTGAGGGCCAAGG + Intronic
1083302935 11:61748264-61748286 GCAGAAGAAACTGAAGGCCAGGG + Intergenic
1083307125 11:61766998-61767020 ACAGAAGAAACTGAGGCCATGGG - Intronic
1083746110 11:64737289-64737311 ACAGGAGAAACAGAGGCTCAGGG + Intronic
1084164993 11:67371466-67371488 ACAGAGGTCACTGAGGCCCAGGG + Intronic
1084509626 11:69595093-69595115 CCTGAGGAATCAGAGGCCCAAGG - Intergenic
1084671028 11:70606759-70606781 GCAGAAGCGCCTGAGGCCCAAGG - Intronic
1085041972 11:73331824-73331846 ACAGAAGCATCAGAGCCCAAAGG + Intronic
1085043521 11:73340618-73340640 TCAGAGGAAGCTGATGCCCAGGG + Intronic
1085054646 11:73396399-73396421 ACAGAAACCACTGAGGCCCAAGG - Exonic
1085359571 11:75874790-75874812 ACTGAAGATTCTGAGACACAGGG + Intronic
1085708875 11:78811381-78811403 AATTAAGAAACTGAGGCCCAGGG - Intronic
1085758738 11:79223723-79223745 ACAGGGGCATCTGAGGCCAAAGG - Intronic
1086227382 11:84528407-84528429 ACAGATGAATCTTAGAACCAAGG + Intronic
1087748972 11:101984804-101984826 TCAGAAGCAGCTGAGGCACAAGG - Intronic
1087949087 11:104197930-104197952 ACAGAAGGATGTGATTCCCAAGG + Intergenic
1088096823 11:106110214-106110236 AATGTAAAATCTGAGGCCCAAGG + Intergenic
1089679930 11:120113666-120113688 AAGGAAGAAACTGAGACCCAGGG + Intronic
1089779716 11:120864944-120864966 GAAAAAGAATCTGCGGCCCACGG - Intronic
1089780593 11:120870684-120870706 AATGAAGAAACTGAGGCACAAGG - Intronic
1090617013 11:128523668-128523690 ACAGAAAAATCTGTGGCTCCTGG + Intronic
1090884957 11:130867822-130867844 ATGGAAGAAACTGAGGTCCAGGG + Intergenic
1090975366 11:131675566-131675588 AAAGGAGACTCTGAGGCCGAGGG + Intronic
1091443687 12:530887-530909 AGGGCAGAATATGAGGCCCACGG + Intronic
1091726224 12:2848426-2848448 ATAGAAAAAGCTGAGGCCCAAGG + Intronic
1091845556 12:3653657-3653679 ACAGTTGAATCTGAGGAACATGG + Intronic
1092242897 12:6846346-6846368 GATGAAGAAACTGAGGCCCATGG - Intronic
1092721125 12:11441848-11441870 AATGAAGAAACTGAGGCGCAAGG + Intronic
1092944673 12:13441657-13441679 ACAGACGACTCTCAGGACCACGG + Intergenic
1092979820 12:13783587-13783609 GCATAAGAATCTGGGGCACATGG + Intronic
1095740317 12:45599469-45599491 ACACAGGAAGCTGAGGCACAAGG + Intergenic
1096009332 12:48199669-48199691 AGAGAAGAAGCTGAGACCCTAGG + Intergenic
1097159917 12:57038830-57038852 GCGGAAGCAGCTGAGGCCCATGG + Exonic
1097279939 12:57838757-57838779 GATGAAGAAACTGAGGCCCATGG - Intronic
1097614912 12:61872259-61872281 ACAGAAGTGTCTTAGGCTCAAGG - Intronic
1097676215 12:62604443-62604465 CCAGCAGAATCTGAGCCCCAAGG - Intergenic
1098476256 12:70907703-70907725 CCAGCAGAGTCTGAGGCCCAAGG - Intronic
1099324821 12:81201537-81201559 ACAGAAGCATATGAGGTCCCTGG + Intronic
1099332187 12:81303573-81303595 ATAGGAGAACCTGAGGCCTATGG - Intronic
1100001694 12:89844460-89844482 ACAGTAGAATCTGAGAACAAGGG - Intergenic
1100482974 12:94996955-94996977 GATGAAGAAACTGAGGCCCAAGG - Intronic
1100826072 12:98475665-98475687 ACAGAAGAATCTTAGGCTCTTGG - Intergenic
1101004879 12:100391769-100391791 GATGAAGAAACTGAGGCCCAGGG - Intronic
1101087995 12:101255704-101255726 GATGAAGAAACTGAGGCCCAAGG + Intergenic
1101591136 12:106126480-106126502 CCAGAGGTAACTGAGGCCCAGGG - Intronic
1101719796 12:107341466-107341488 GCTGAAGAAACTGAGGCCCATGG - Intronic
1102033436 12:109757909-109757931 ACAGACAAATCTGGGGCCCTGGG + Intronic
1102237530 12:111303655-111303677 AGAAAAGAAACTGAGACCCAGGG + Intronic
1102415657 12:112760294-112760316 AAAGAAGACAATGAGGCCCAGGG - Intronic
1102625099 12:114228512-114228534 AAAGAAGAATCCGAGGCCCCCGG + Intergenic
1102927335 12:116836255-116836277 ACAGGAGAATCAGAGGCTCTCGG - Exonic
1103484537 12:121273945-121273967 CCAGAAGGATCTGAGTGCCACGG - Intronic
1105583727 13:21724615-21724637 ACTGAGGAAACTGAGGCTCAGGG + Intergenic
1106479633 13:30127466-30127488 AGAGGAGAACCTGAGGCACAAGG + Intergenic
1106980763 13:35277031-35277053 ACATAAGCATCTGTGGCCCCAGG + Intronic
1107238216 13:38198526-38198548 ACAGGAAAATCAGAGGTCCAGGG + Intergenic
1107814024 13:44228177-44228199 ACAGAAGAATCTGGAGCCTAAGG - Intergenic
1107904639 13:45050854-45050876 ACAGAAGAAGGTCAGGCCAAGGG - Intergenic
1108373616 13:49793617-49793639 ACAGGAGAGTCTGCGGACCAGGG - Intergenic
1110117136 13:71833145-71833167 ACAGATGAATCTGATGCACTAGG - Intronic
1112050333 13:95639167-95639189 AGAGTAGAAACTGAGGCACAGGG + Intronic
1113956550 13:114102597-114102619 GGAGAAGATGCTGAGGCCCAGGG + Intronic
1114646706 14:24260102-24260124 CCAGAAGTAGGTGAGGCCCAGGG - Intronic
1115032663 14:28815384-28815406 ACAGAAGAATCTGAATCCCCTGG - Intergenic
1115371136 14:32616014-32616036 AGAAAGGAATCTGAGGCTCAGGG - Intronic
1115416159 14:33136556-33136578 ACTGAAGAAACTGAGACCCTGGG + Intronic
1115936218 14:38556033-38556055 ACATAAGAAGCAGACGCCCATGG - Intergenic
1117840638 14:59857157-59857179 ACTATAGAATCTGAGGCTCAGGG + Intronic
1118040161 14:61907778-61907800 ACAGAAGGGTGTGAGCCCCAGGG + Intergenic
1118989527 14:70785160-70785182 ACAGAGGAAGCTGAGGCTCAGGG - Intronic
1119196385 14:72719797-72719819 GATGAAGAAACTGAGGCCCAGGG + Intronic
1119319582 14:73721688-73721710 ACAGAAGAGTCTCAAGCCCTGGG + Intronic
1119320827 14:73729363-73729385 ACTGAAAAAACTGAGGCCCAGGG + Intronic
1119439937 14:74621443-74621465 GATGAGGAATCTGAGGCCCAGGG - Intergenic
1119559681 14:75579971-75579993 CCAGAATAGTCTGATGCCCAGGG - Intronic
1121032972 14:90675082-90675104 ACAGAACAATGGGAAGCCCAGGG + Intronic
1121578760 14:95010609-95010631 GCTGAGGAATCTGAGGCTCAGGG - Intergenic
1121712044 14:96045614-96045636 ACAGAAGCACCTGCGGCCCCAGG - Intronic
1122267196 14:100552199-100552221 CCAGGGGAAACTGAGGCCCAGGG + Intronic
1122696125 14:103553352-103553374 TCAGAAGAAACTGAAGCTCAAGG + Intergenic
1123145356 14:106124515-106124537 ATAAAAGAATCTGAGGTCAATGG + Intergenic
1123585395 15:21755690-21755712 ATAAAAGAATCTGAGGTCAATGG + Intergenic
1123622042 15:22198299-22198321 ATAAAAGAATCTGAGGTCAATGG + Intergenic
1126274925 15:46866035-46866057 GCAAAAGAAACTGAGGCTCAGGG - Intergenic
1126588188 15:50311288-50311310 AAAGCAGAATTTTAGGCCCATGG + Intronic
1127287101 15:57541796-57541818 GCAGAGGAAACTGAGGCCTACGG - Intronic
1127958150 15:63870913-63870935 AAGGAGGAAACTGAGGCCCAGGG + Intergenic
1128243895 15:66119797-66119819 AAGGAAGAAGCTGAGGCCCATGG + Intronic
1128293453 15:66497159-66497181 AAGGAAGAAACTGAGGCCCTGGG - Intronic
1128557641 15:68642483-68642505 ACACCAGAACCTGAGGCTCAGGG - Intronic
1128802073 15:70503339-70503361 AATGTAGAAACTGAGGCCCAAGG + Intergenic
1129517908 15:76168052-76168074 GAAGGAGAAACTGAGGCCCAGGG + Intronic
1129942138 15:79507406-79507428 ACTGCAGAAACTGGGGCCCATGG + Intergenic
1130010939 15:80152742-80152764 ACTGGAGGACCTGAGGCCCACGG + Intronic
1130146812 15:81280742-81280764 ACAGAGGCATCTGAGGCCTCAGG - Intronic
1130578249 15:85112605-85112627 AATGAAGAAACTGAGGCCCAAGG - Intronic
1130983840 15:88831723-88831745 GATGAAGAAACTGAGGCCCAAGG - Intronic
1131222157 15:90593837-90593859 AATGAAGATTCTGAGGCCAAAGG - Intronic
1131257714 15:90872658-90872680 ACCAAGGAAACTGAGGCCCAGGG + Intronic
1131468162 15:92672448-92672470 ATCGAGGAAACTGAGGCCCAGGG - Intronic
1132259383 15:100408905-100408927 AGAGAGGAAACTGAGGCTCAGGG + Intronic
1134422362 16:14106158-14106180 CCAGGAGAATCTGAGCTCCATGG - Intronic
1134787569 16:16959003-16959025 ATAGAAGAAGCAGAGGCTCAGGG - Intergenic
1135133342 16:19870340-19870362 AAAGAAGAATCTGAGACACAAGG - Intronic
1135263429 16:21000654-21000676 GATGAAGAAACTGAGGCCCATGG - Intronic
1135645122 16:24154971-24154993 ACAGAAAGATGTAAGGCCCAGGG + Intronic
1136026731 16:27473532-27473554 ACAGAGGAGGCTGAGGCACATGG + Intronic
1136513542 16:30753950-30753972 TCAGGTGAACCTGAGGCCCAGGG - Intronic
1136541694 16:30930817-30930839 TCAGATGAAGCTGAGGCCCAAGG + Intronic
1136693749 16:32057268-32057290 ATAAAAGAATCTGAGGTCAATGG - Intergenic
1136794237 16:33000503-33000525 ATAAAAGAATCTGAGGTCAATGG - Intergenic
1136875670 16:33853876-33853898 ATAAAAGAATCTGAGGTCAATGG + Intergenic
1137097577 16:36329461-36329483 TCCGAAGGCTCTGAGGCCCATGG + Intergenic
1137295549 16:47089379-47089401 AAAGAGGAAGCCGAGGCCCAAGG - Intronic
1137529615 16:49270182-49270204 TCAGGAGAAGCTGAGGTCCATGG - Intergenic
1138659832 16:58510431-58510453 CCAGAAGGATCTCTGGCCCAAGG - Intronic
1139656062 16:68387827-68387849 TCAGAAGAATCTGAAAGCCAAGG + Intronic
1140150682 16:72361589-72361611 GCAGGAGAATCTGATGCCCTTGG + Intergenic
1141383328 16:83596087-83596109 ACAGAATCAGGTGAGGCCCAGGG + Intronic
1141618956 16:85226574-85226596 TAAGAAGAAACCGAGGCCCAAGG - Intergenic
1141639606 16:85333586-85333608 GAGGAAGAAACTGAGGCCCAGGG - Intergenic
1142361473 16:89629617-89629639 ACGGAAGAATCTTAATCCCAGGG - Intronic
1142397856 16:89842837-89842859 ATAGAACAATGTGTGGCCCACGG - Intronic
1203096501 16_KI270728v1_random:1262184-1262206 ATAAAAGAATCTGAGGTCAATGG - Intergenic
1143099280 17:4496609-4496631 AATGAAGAAACTGAGGCCCAGGG - Intergenic
1143159688 17:4861015-4861037 TCAGAAGAAGCTGAGGAACAAGG - Intronic
1143198036 17:5091547-5091569 TCTGAAGAATCTGAGCCACATGG + Exonic
1143330658 17:6132551-6132573 ACACAGGAATGTGGGGCCCATGG + Intergenic
1143615391 17:8046437-8046459 ACAAAACAACCTGAGGCTCAGGG + Intronic
1143733398 17:8894099-8894121 CCAGGAGAAACTGAGGCCCAGGG - Intronic
1143787801 17:9269201-9269223 AAAGAAGTATTTGAGGCCCAAGG + Intronic
1144892202 17:18500592-18500614 GATGAAGAAACTGAGGCCCAGGG + Intergenic
1144951777 17:18998310-18998332 AGTGAAGAAACTGAGGCCGAGGG + Intronic
1145007313 17:19344922-19344944 AAAGGAGAAACTGAGGCGCAGGG - Intronic
1145140014 17:20443696-20443718 GATGAAGAAACTGAGGCCCAGGG - Intergenic
1145738077 17:27247535-27247557 GCAGAACAATGTCAGGCCCAGGG + Intergenic
1146318848 17:31830789-31830811 AGGTAAGAAACTGAGGCCCAGGG + Intergenic
1146931590 17:36782053-36782075 TCTGAAGAATCTGAGGCCCAGGG + Intergenic
1147539006 17:41341146-41341168 ACTGAAGAATCTGAGCTCGAGGG - Intergenic
1147734834 17:42629484-42629506 AATGATGAAACTGAGGCCCAGGG - Intergenic
1148483593 17:47976315-47976337 ACAGAAGCAGCTGAGGCCTGTGG + Intronic
1148630698 17:49106141-49106163 AGAGTAGAAGTTGAGGCCCAGGG + Intergenic
1148677379 17:49453104-49453126 ATGGAGGAAACTGAGGCCCAGGG + Intronic
1149351497 17:55792653-55792675 GAGGAAGAAACTGAGGCCCAGGG - Intronic
1149696035 17:58616796-58616818 CCTGAAGAAACTGAGGCTCATGG + Intronic
1150089061 17:62304894-62304916 AAAGAAGAAGATGAGTCCCAGGG + Intergenic
1150462788 17:65366422-65366444 AATGAAGAAACCGAGGCCCAGGG - Intergenic
1151088101 17:71404451-71404473 AAAGAGGAAACTGAGGTCCAAGG - Intergenic
1152829329 17:82487496-82487518 AAAGAAGAATGAGAGGCACACGG + Intronic
1152911289 17:83006243-83006265 ACCGAGGCATCTGAGGCCCCTGG + Intronic
1152991255 18:365880-365902 AGTGAAGAAACTGAGGCCCAAGG + Intronic
1153613205 18:6908765-6908787 AGACAAGAAGCTGAGGCCCAGGG - Intronic
1153962256 18:10149777-10149799 ATAGAAGCATCTGGGGACCAGGG - Intergenic
1154324367 18:13379510-13379532 ACACAAGGATCTGGGCCCCATGG + Intronic
1156705803 18:39880496-39880518 ACATGAGGATCTGAGGGCCAAGG + Intergenic
1157712500 18:49859598-49859620 AGAGAAACATCTGAGGCCCTAGG + Intronic
1157866555 18:51191771-51191793 AAAGAGGAATCTGAAGCCTAGGG + Intronic
1157991814 18:52505430-52505452 AGAGAAGAATCAGAGACCAAGGG - Intronic
1158007998 18:52695210-52695232 ACTGAAGAAATTGAGGCCCATGG - Intronic
1158213502 18:55075994-55076016 ACTGATGAAACTGAGGCACAGGG + Intergenic
1158313790 18:56188473-56188495 CCAGGAGAATCTGTGGCCCCAGG + Intergenic
1158443156 18:57495247-57495269 AAAGAGAAATCTGAGGCTCAGGG + Intergenic
1158666982 18:59441148-59441170 ACAGTAGAGACTGAGGCACATGG - Intronic
1158738647 18:60113457-60113479 ACAGGATAACCTGGGGCCCATGG - Intergenic
1158795326 18:60838919-60838941 AAGGAAGGAGCTGAGGCCCAAGG - Intergenic
1159555787 18:69943093-69943115 ACAGAAGACACTGAGGTTCAGGG - Intronic
1160605787 18:80048703-80048725 AATAAGGAATCTGAGGCCCAGGG + Intronic
1160703990 19:520876-520898 ACAGGAGACACTGAGGCCAAGGG - Intergenic
1160737052 19:667678-667700 AATGAGGAAACTGAGGCCCAGGG + Intergenic
1160915188 19:1493013-1493035 AGAGACGAAACTGAGGCACAGGG + Intronic
1161462018 19:4403095-4403117 AGAGGGGAAACTGAGGCCCAGGG + Intronic
1161529044 19:4776053-4776075 GGAGAGGAAACTGAGGCCCAGGG + Intergenic
1162495465 19:11020999-11021021 AGGGAGGAAACTGAGGCCCAGGG + Intronic
1162775821 19:12978452-12978474 GCATAAGAAAGTGAGGCCCAAGG + Intergenic
1162835320 19:13313180-13313202 AGAGGGGAAACTGAGGCCCATGG - Intronic
1162926963 19:13935675-13935697 ACAGATGTATCTGAGGCCTGGGG + Intronic
1163148315 19:15397170-15397192 CCAGAAGCATCTGAAGACCATGG - Exonic
1164455783 19:28405522-28405544 ACTGAAGGAGGTGAGGCCCAGGG - Intergenic
1164573581 19:29391950-29391972 GCAGAGGAACCTGTGGCCCAAGG + Intergenic
1164608617 19:29617515-29617537 AAAGCATGATCTGAGGCCCAGGG + Intergenic
1165075312 19:33277037-33277059 GCAGGAGAATGTGAGCCCCATGG + Intergenic
1165381948 19:35488012-35488034 ACAGAGGAAGCGGAGGCCGAGGG + Intronic
1165827785 19:38715017-38715039 AGTGAGGAAACTGAGGCCCAGGG + Intronic
1165949650 19:39466899-39466921 GCAGAAGAAACTGAGGCACAGGG - Intronic
1166046145 19:40232244-40232266 ACAGGAGGAGCTGGGGCCCAGGG + Exonic
1166210920 19:41306105-41306127 AAAGAGGACTCTGAGGCCCCTGG - Intronic
1166647749 19:44544731-44544753 AATGAAGAACCTGAGGCTCAGGG + Intergenic
1166812130 19:45521069-45521091 ACAGGAGAAGCTAAGGCCCGGGG - Intronic
1166949108 19:46414588-46414610 GCTGAGGAAACTGAGGCCCAAGG + Intergenic
1167064325 19:47172915-47172937 AGAGGGGAATCTGAGGCTCAGGG + Intronic
1167463637 19:49639065-49639087 CCAGAAGAGTCTCAGGGCCAGGG + Intronic
1167508269 19:49882466-49882488 AAAGAGGAAACTGAGGCCCAGGG - Intronic
1167516632 19:49927194-49927216 ACAGGGGAAACTGAGGCACAGGG + Intronic
1167685561 19:50953626-50953648 ACAGAAACACCTGTGGCCCAAGG - Intergenic
925720504 2:6822155-6822177 AGGGAAGAATCTGGAGCCCAGGG - Intergenic
926061697 2:9808667-9808689 AGAGGAGAAACTGAGGCCCGAGG - Intergenic
926086619 2:10024022-10024044 AATGAGGAAACTGAGGCCCAAGG - Intergenic
926212717 2:10883067-10883089 AATGAGGAATCTGAGGCCCCAGG + Intergenic
926446260 2:12946458-12946480 ACAGAAGAGGCTGAGTCCCGAGG + Intergenic
927195209 2:20542100-20542122 AGTGAGGAATCTGAGTCCCAGGG + Intergenic
927207729 2:20620659-20620681 ATAGAAGAGACTGAGGACCAGGG - Intronic
927785496 2:25971476-25971498 ACAGAAGAGTCCCAGGCCCTGGG - Intronic
929165413 2:38876329-38876351 ATAGCGGAAACTGAGGCCCAGGG - Intronic
929840648 2:45459161-45459183 ACAGAAGAATCAGATACACAAGG + Intronic
929979920 2:46668758-46668780 ACAGAAGAAGCAGATGCCTACGG + Intergenic
931189044 2:59982001-59982023 ACTTGAGAATCTGAGGTCCAGGG - Intergenic
931223472 2:60309169-60309191 AAAGAAGAAACTGAGGCCCCAGG + Intergenic
931371656 2:61668872-61668894 GAAGAAGCATCTGAGGGCCATGG + Intergenic
931396184 2:61889951-61889973 AAAGAAGGAACTGAAGCCCAGGG + Intronic
931473769 2:62567409-62567431 AAAGAAGAATTTGAGTCACAAGG - Intergenic
932063859 2:68532504-68532526 TCAGAGGAAACTGAGGCCCAAGG + Intronic
932209110 2:69913259-69913281 CGTGAAGAAACTGAGGCCCAGGG - Intronic
932966279 2:76479029-76479051 ACAGAAGAAACTTAGGCAGAAGG - Intergenic
933781393 2:85804394-85804416 TCTGAGGAAACTGAGGCCCAGGG + Intergenic
933806462 2:86001491-86001513 ACAGAAAAATCTGGGGCCCCAGG + Intergenic
933830727 2:86205978-86206000 ACAGATGAGTCTGATGCTCAGGG + Intronic
935051587 2:99529341-99529363 GCCGAGGACTCTGAGGCCCAGGG - Intergenic
935099169 2:99976357-99976379 AGATTAGAAGCTGAGGCCCAAGG + Intronic
935705145 2:105850101-105850123 ACAGAAGAAACTGAAATCCAAGG + Intronic
936029630 2:109060729-109060751 ACATGGGAAACTGAGGCCCAGGG - Intergenic
936060556 2:109293167-109293189 ACAGCACCATCGGAGGCCCAGGG - Intronic
936115775 2:109701888-109701910 ACAAAAGAATCAGAAGCTCAGGG - Intergenic
936440553 2:112548315-112548337 GCAGAGGAAACTGAGGCTCAGGG - Intronic
938551265 2:132384458-132384480 ACAGAAAAACTGGAGGCCCAGGG - Intergenic
938669327 2:133572049-133572071 ACCAAGGAAACTGAGGCCCAGGG + Intergenic
938774024 2:134525327-134525349 TCAGCAGATTCTGAGGCCCCTGG + Intronic
939840479 2:147182034-147182056 ATAGAAGAATAGGAGGCCCTCGG + Intergenic
940034104 2:149295253-149295275 ACAGAAGAATCTGAGGAAACAGG - Intergenic
940139271 2:150475352-150475374 AGTGAAGAATCAGAGGCACAGGG - Intronic
941015707 2:160353750-160353772 ACTGAAAAAGCTGAGGCTCAGGG - Intronic
941728487 2:168890029-168890051 ACAGAGGATACTGAGGCCCGAGG - Intronic
942676022 2:178427691-178427713 AAAGAAGAATCTGGGTCCCCAGG - Intergenic
944136271 2:196403107-196403129 ACAGAAGAATAAGAATCCCAAGG - Intronic
944705495 2:202284620-202284642 ACAGATGAAACTGAAGCCCAAGG + Intronic
944810741 2:203325604-203325626 ACAGCAGAATCTGAGATGCAAGG - Intergenic
944810940 2:203327658-203327680 ACATAAAAAGCTGAGGCCCACGG + Intergenic
945373514 2:209051458-209051480 ACAGACGAATTTCAGGCCAAAGG - Intergenic
945395845 2:209316344-209316366 TCAGACGAATGAGAGGCCCATGG - Intergenic
945616252 2:212071991-212072013 GAAGAAGAAACTGAGGCTCAGGG + Intronic
946112032 2:217428281-217428303 ACTGCAGAATCTAGGGCCCATGG + Intronic
946157911 2:217818925-217818947 GAAGAAGAAACTGAGGCTCAGGG + Intronic
947745584 2:232505869-232505891 ACAGGACACTCTGAGGCCCCAGG + Intergenic
948127593 2:235576181-235576203 ACTGGGGAACCTGAGGCCCAGGG - Intronic
948173439 2:235924951-235924973 GAAGAAGAAACTGAGGCCCGTGG + Intronic
1169158380 20:3354102-3354124 ACAGAAGAGACTGAGGCACCAGG + Intronic
1170208490 20:13824456-13824478 TCAGAGGAATCTGGGTCCCAAGG + Intergenic
1170961919 20:21033136-21033158 AACGAGGAGTCTGAGGCCCAGGG - Intergenic
1172134018 20:32675215-32675237 ACAGAAGACACAGAGACCCAAGG - Intergenic
1172307660 20:33892784-33892806 CTAGAAGAATTTGAAGCCCACGG + Intergenic
1173200415 20:40950684-40950706 GGAGAAGAAACTGAGGCTCAAGG - Intergenic
1173274088 20:41564084-41564106 AATGAAGAAACTGAGACCCAGGG - Intronic
1173455847 20:43200519-43200541 GGAGAAGAAACTGAGGCACAAGG + Intergenic
1173650978 20:44664005-44664027 ATAGTAGAATCTTAGGCTCAGGG - Intergenic
1173736598 20:45366026-45366048 AAAGAGGAGCCTGAGGCCCATGG - Intronic
1173968542 20:47132540-47132562 GCTGAAGAAACTGAGGCCCAGGG + Intronic
1174393435 20:50232153-50232175 AAGGGAGAAACTGAGGCCCAAGG + Intergenic
1174764011 20:53234812-53234834 ACATAGAAATCTGAGGGCCATGG + Intronic
1175296531 20:57912614-57912636 GGAGGAGAAACTGAGGCCCAGGG + Intergenic
1175920794 20:62449826-62449848 ACAGAAGAGTCTTGGGCCCCGGG + Intergenic
1178527642 21:33345562-33345584 AGTGAAGAAATTGAGGCCCATGG - Intronic
1179189805 21:39114188-39114210 AGTGAAGAAACTGAGGCACAGGG + Intergenic
1179887974 21:44322538-44322560 ACAGAAGGGTCTCAGGCCCTGGG - Intronic
1181164376 22:20975631-20975653 GCAGAAGACACTGGGGCCCAGGG - Intronic
1181456057 22:23060862-23060884 ACACAAGAGGCTGAGACCCAGGG - Intronic
1182446643 22:30393489-30393511 CCAGAAGAATCTGAAGCACAGGG + Intronic
1182546370 22:31079057-31079079 ACAGAGGAAGCTGAAGCTCAGGG - Intronic
1183360553 22:37380899-37380921 AGACAAGGAACTGAGGCCCAGGG - Intronic
1184057969 22:42065357-42065379 ACAAAAGGATCAGAGGCACACGG + Intronic
1184297216 22:43532415-43532437 GAAGGAGAAACTGAGGCCCAGGG + Intronic
1184841379 22:47054342-47054364 GCAGAAGAAAATGAAGCCCAAGG - Intronic
949357987 3:3202104-3202126 ACAAAGGACTCTGAGGCCCGAGG - Intergenic
949506112 3:4729226-4729248 GCAGAAGAAACTGAGGCACAGGG - Intronic
949519414 3:4836178-4836200 ACAGCATAATATGAGGCCCCTGG + Intronic
950276348 3:11664574-11664596 AGAGAAGAATCTGGGGACCAGGG + Intronic
950325755 3:12108284-12108306 ATTGGAGAATCTGAGGCCCTTGG + Intronic
950412989 3:12851066-12851088 AAGGAAGAAACTGAGGCTCAGGG - Intronic
950640453 3:14345128-14345150 AGAGAGGAAACTGAGGCCCAGGG - Intergenic
951611969 3:24499532-24499554 GTAGAAGATTCTGAGGCCCTGGG + Intergenic
952084656 3:29803109-29803131 AATGAAGAAGCTGAGGCTCAGGG + Intronic
952257317 3:31706521-31706543 AGATAAGAAGCAGAGGCCCATGG - Intronic
952315306 3:32227184-32227206 AATGAGGAATCTGAAGCCCAGGG - Intergenic
952878386 3:37967255-37967277 AGAGGAGAAACTGAGGTCCAAGG + Intronic
952881261 3:37987419-37987441 AGAGGGGAAACTGAGGCCCAGGG - Intergenic
953076262 3:39573379-39573401 AGAGAACATTCTGAAGCCCAAGG + Intergenic
953117489 3:40007551-40007573 AAAGAAGAAACTGAGGTTCATGG - Intronic
953377784 3:42443308-42443330 TCAGCAGAATCTTAGGTCCATGG + Intergenic
954269095 3:49493472-49493494 ACAGAAGAAGCTGAGAGCAAGGG + Intronic
954436117 3:50497260-50497282 AGAAAGGAAACTGAGGCCCAGGG + Intronic
954438628 3:50509454-50509476 GATGAAGAAACTGAGGCCCATGG + Intergenic
954634252 3:52063000-52063022 AATGGAGAAACTGAGGCCCATGG + Intergenic
954634486 3:52064263-52064285 ACAGAACAGGCTGAGGCCCAAGG - Intergenic
954664473 3:52244550-52244572 ATGGACGATTCTGAGGCCCATGG - Intergenic
956068652 3:65423728-65423750 GAAGAGGAAGCTGAGGCCCAGGG - Intronic
956428743 3:69163673-69163695 AGAGAGGAAACTGAGGCCCAGGG + Intergenic
957226909 3:77460856-77460878 ACTGAAGAATCAGATGGCCATGG - Intronic
959562262 3:107796111-107796133 AATGAAGAAACAGAGGCCCATGG + Intronic
960202058 3:114848762-114848784 GCAAAAGAATCTGCTGCCCAGGG + Intronic
960617512 3:119609419-119609441 CCAGCAGACTCTGTGGCCCACGG + Intronic
960938669 3:122919431-122919453 TCAGGAGAATCTCAGCCCCACGG - Intronic
961269743 3:125680120-125680142 CCAGAAGAATATCAGGCCCCAGG + Intergenic
961518822 3:127455481-127455503 ACAGAAGACAGAGAGGCCCAGGG + Intergenic
961602619 3:128073037-128073059 GGTGAAGAAACTGAGGCCCAGGG + Intronic
961813320 3:129534212-129534234 GGAGAAGAAAGTGAGGCCCAGGG - Exonic
962035645 3:131648813-131648835 ACTAAAGAAAATGAGGCCCAGGG + Intronic
962924832 3:139982418-139982440 ACAGAAGCATCTGAATACCAAGG - Intronic
964405902 3:156349066-156349088 ACAGAGGAAACTGAGACACAGGG + Intronic
964619193 3:158703889-158703911 ACAGAAGAGTCTGAAGTTCAGGG - Intronic
965612183 3:170556110-170556132 AAAGAAGAAACTGAAGCCCAGGG - Intronic
965671870 3:171156058-171156080 AAAGAAGAAACTGAGGTTCAGGG - Intronic
965902492 3:173659577-173659599 AAAGAAGACTCTGTGGCCCAAGG - Intronic
966503484 3:180672693-180672715 ACAGAACATTCTGCAGCCCATGG + Intronic
966613429 3:181890556-181890578 AATGAAGAAACAGAGGCCCAGGG + Intergenic
966643337 3:182215116-182215138 AGTGAAGAAACTGAGGCTCAGGG - Intergenic
966807744 3:183819767-183819789 TCAGAAGAAACTGAGGCTCAGGG - Intronic
968289664 3:197528787-197528809 TAAGAGGAAACTGAGGCCCAGGG + Intronic
968540378 4:1165312-1165334 ACAGAAGTCTCTGGGGCCCCAGG - Intergenic
969669002 4:8579542-8579564 AGATGAGAATGTGAGGCCCAAGG + Intronic
969669014 4:8579599-8579621 AGATGAGAATGTGAGGCCCAAGG + Intronic
969965898 4:10995180-10995202 ACAGAAGCAGCTTAGCCCCATGG + Intergenic
970464229 4:16306934-16306956 AAAAAAGAAACTGAGACCCAGGG + Intergenic
970968559 4:21954998-21955020 GAAGAAGAAACTGAAGCCCATGG + Intergenic
972139689 4:35942272-35942294 ACAGGAAAATCTGAGGCAGAGGG + Intergenic
972672057 4:41221947-41221969 ACAGAGGAAACTGAGGCCAAGGG + Intergenic
973116976 4:46473738-46473760 ACTGAAGAATCTGAGGTTCAGGG + Intronic
974570562 4:63641894-63641916 ACAAAGAAATCTGAGGCACAGGG + Intergenic
974610104 4:64206015-64206037 AGACAAGAACCTGGGGCCCAAGG - Intergenic
976300445 4:83510911-83510933 ACAGAAGTAAATGAGTCCCAGGG - Intronic
976381296 4:84402167-84402189 AGTGGAGAATCTGAGGCCAAGGG - Intergenic
976677945 4:87724217-87724239 AAAGAGGAAACTGAGGCCCAAGG - Intergenic
976831255 4:89317348-89317370 ACAGAAGACTCAAAGGCCCTGGG + Intergenic
977759198 4:100710924-100710946 ACAAAAGAAACTGAGGACTATGG - Intronic
978355279 4:107866014-107866036 ACAGAAGAAACTAAGGACCAAGG + Intronic
978484506 4:109235933-109235955 ATAGAAGAATCTGTGTCACAGGG - Intronic
978676392 4:111323980-111324002 ACAGAAAGCTCTGAGGCACATGG + Intergenic
980492737 4:133550460-133550482 ACAGAAAAATCTGATGACCAGGG - Intergenic
980696788 4:136367477-136367499 TCAGGAGAATCTAAGGCACAAGG - Intergenic
982270521 4:153581539-153581561 ACAGATGAATCTGAGACCTCAGG + Exonic
982271523 4:153594184-153594206 AAAAAAGAATTTGAGGGCCAAGG - Intronic
983514909 4:168645561-168645583 AAAGAGGAAACTGAGGCCCAGGG - Intronic
984280534 4:177664874-177664896 ACAGATGAAACGGAGGTCCAGGG + Intergenic
984388588 4:179097478-179097500 ATGGAGGAATCTGAAGCCCATGG + Intergenic
984646462 4:182225598-182225620 ACAAAATGATCTGAGGCCCACGG + Intronic
984700073 4:182813654-182813676 ACAGAGGAAACTGAGGGGCAGGG - Intergenic
985032324 4:185801846-185801868 AAAGAAGAAACTGAGGCTCAGGG - Intronic
985993444 5:3582789-3582811 ATAGAAGTATCTGAGTGCCAGGG + Intergenic
986565140 5:9105544-9105566 AGAGAAGCAGCTGAAGCCCATGG + Intronic
986727892 5:10613113-10613135 ACTGAAGCACCAGAGGCCCAGGG - Intronic
987420342 5:17712823-17712845 ACAGAAGAGCTTGAAGCCCATGG + Intergenic
987913655 5:24183985-24184007 ACAGAAGAATGGGAGGTACATGG - Intergenic
988714184 5:33808778-33808800 GATGAAGAAACTGAGGCCCAAGG + Intronic
988786672 5:34571526-34571548 ACATAAGAATCTGAGGCTTTAGG - Intergenic
989321115 5:40134808-40134830 ACAGAGAAAGCTGAGGCCTATGG - Intergenic
991008241 5:61853557-61853579 ACAGAAAAACATGAGGCACATGG + Intergenic
991386513 5:66096203-66096225 ATAAAAGAATCTGAGGCCCAAGG - Intergenic
992022694 5:72639859-72639881 ATAGAAAAATCTAAGGCCCTAGG - Intergenic
992156332 5:73958605-73958627 AAAGAGGAAGCTGATGCCCACGG + Intergenic
992547132 5:77824156-77824178 AGAGAAGAAACTGAGCCACAAGG + Intronic
992816755 5:80448826-80448848 ACAAAGGAAACTGGGGCCCAAGG - Intronic
993823859 5:92656772-92656794 ACAGTAGAATCTGAGACCATTGG - Intergenic
994499013 5:100550818-100550840 AGAGAAGACTGTGAGGCCAATGG + Intronic
995540516 5:113181863-113181885 ACTGTAAATTCTGAGGCCCAGGG + Intronic
995629441 5:114117469-114117491 GCTGAAGAAACAGAGGCCCAAGG - Intergenic
995851553 5:116551549-116551571 AAGGAGGAAACTGAGGCCCAAGG + Intronic
997799092 5:136841975-136841997 TATGAAGAAACTGAGGCCCAAGG + Intergenic
998109250 5:139488411-139488433 AAAGAGGAAGCTGAGGGCCATGG + Intergenic
999298333 5:150474533-150474555 AATGGAGAAACTGAGGCCCAGGG - Intergenic
999329474 5:150662756-150662778 GCAGAGGAGACTGAGGCCCAGGG - Intronic
999370352 5:151051502-151051524 AGAGGGGAAACTGAGGCCCAGGG - Intronic
999711736 5:154323929-154323951 ACAGAAGGTGCTGAGGCTCAAGG - Intronic
1000346663 5:160320319-160320341 GAAGGAGAAACTGAGGCCCATGG - Intronic
1001162836 5:169336549-169336571 ACAGCAGAACCTGAGTCCCTGGG - Intergenic
1001595847 5:172898315-172898337 AAAGAGGAAATTGAGGCCCAGGG + Intronic
1001608724 5:172983051-172983073 GTTGAAGAAACTGAGGCCCAGGG - Intergenic
1001682592 5:173569823-173569845 AAAGGGGGATCTGAGGCCCACGG - Intergenic
1001724135 5:173882511-173882533 ACTGAGGAAACTGAGGCCCAAGG - Intergenic
1001881552 5:175249051-175249073 AGAGAGCAAACTGAGGCCCAAGG + Intergenic
1003396295 6:5755632-5755654 ACAGAAGGATCAGTGTCCCAAGG - Intronic
1005301596 6:24476387-24476409 ACAGAAGAAACTGAGGGGCATGG - Intronic
1005402397 6:25448319-25448341 ACAGAAGAATCTGGGGAGCAAGG - Intronic
1005517857 6:26571666-26571688 ATAGAACAATCTGAGGACTAGGG + Intergenic
1006247919 6:32756556-32756578 ACAGAGGATGCTGAGGTCCAGGG + Intronic
1006653634 6:35571428-35571450 AAAGTAGACTATGAGGCCCATGG + Intergenic
1006735129 6:36267974-36267996 GCAGAAGACTCTCAGGGCCAGGG - Intronic
1007450640 6:41938826-41938848 GCAGAGGAGGCTGAGGCCCAAGG - Intronic
1007760397 6:44129904-44129926 AATGAAGAAACTGAGGCCCAGGG + Intronic
1008053394 6:46922628-46922650 AAAGAGGAAACTGAGGCCCAAGG + Intronic
1008426424 6:51363357-51363379 AATGAAGAAACTGAGGTCCAGGG - Intergenic
1008450685 6:51646995-51647017 ACAGAGGACTCTGGGGACCATGG - Intronic
1008490321 6:52079609-52079631 AATGAACAATCTGAGGCTCAGGG - Intronic
1009729686 6:67584381-67584403 ACAGAATAATATGAGGCCTCTGG + Intergenic
1009876374 6:69510863-69510885 ACAGAAACAACTGAGTCCCAAGG + Intergenic
1009951760 6:70405319-70405341 ACAGAAGAAACTGAGGACTCAGG + Intergenic
1010158059 6:72817936-72817958 AAAAAAGAAACTGAGGACCAAGG + Intronic
1010572479 6:77494632-77494654 AAGGAAGAAACTGAGGCACAGGG - Intergenic
1010932343 6:81818190-81818212 ACAGTAGAATCAAAGGCCTAAGG - Intergenic
1011201774 6:84844924-84844946 ACAGAGGAAACCAAGGCCCAGGG + Intergenic
1011552648 6:88544202-88544224 ACAAAAAAATCTAAGACCCAGGG - Intergenic
1012171688 6:96024350-96024372 ACAGAAGAATCAGAGGGTAAGGG + Intronic
1012352000 6:98263281-98263303 CCAGAAGACTCTGAGGCTAATGG + Intergenic
1013289170 6:108706001-108706023 ACAAATGAAGCAGAGGCCCATGG - Intergenic
1014238876 6:118992358-118992380 ACACATGAATCTGAGGCTAAGGG - Intronic
1014268965 6:119314512-119314534 ACATATGAAGCTGAGGCCCAAGG + Intronic
1015055993 6:128904055-128904077 CCTTAAGAGTCTGAGGCCCAGGG + Intronic
1015123604 6:129728102-129728124 AAAATAAAATCTGAGGCCCAAGG - Intergenic
1015391857 6:132691369-132691391 AGAGAAGAATGAGAGGACCATGG + Intronic
1015685170 6:135850952-135850974 AAAGAACAAGCTGAGGCCCCAGG + Intergenic
1016281086 6:142419669-142419691 GAAGAAGAAACTGAGGTCCAAGG + Intronic
1017053097 6:150412149-150412171 ACAGAACAATTTGTGTCCCATGG - Intergenic
1017234345 6:152104026-152104048 AGTCAAGAAACTGAGGCCCAGGG - Intronic
1017341917 6:153333823-153333845 ACAGAAAAAGCTGAGGGCTATGG - Intergenic
1017952663 6:159149410-159149432 GCAGCAGACTCTGAGGCCCTTGG - Intergenic
1018268115 6:162047405-162047427 ACACAAGAATATGGAGCCCACGG + Intronic
1018431279 6:163724685-163724707 ACAAAAGAAACTAAGGCCCGGGG - Intergenic
1020582216 7:10017566-10017588 CCAGAAGCATCTGAGTCCCTCGG - Intergenic
1021605514 7:22405652-22405674 AGTGAGGAAACTGAGGCCCAGGG - Intergenic
1021764073 7:23929317-23929339 AATGAGGAAACTGAGGCCCAGGG + Intergenic
1022546446 7:31193534-31193556 TCACAAGAAACTGAGGCCCAGGG + Intergenic
1024384560 7:48736940-48736962 ACAAAAAAAACTAAGGCCCAGGG + Intergenic
1025027938 7:55533608-55533630 TCTGAAGAAGCTGAGGCTCAGGG - Intronic
1025871753 7:65440858-65440880 TCAGAAGAAGCTGAGGACCTAGG - Intergenic
1026050622 7:66943579-66943601 CATGAAGAAACTGAGGCCCAGGG - Intronic
1026825350 7:73578291-73578313 AGAGGAGAAACTGAGGCCCATGG + Intronic
1026919401 7:74144251-74144273 AAAGAAAAATCTGTGACCCATGG - Intergenic
1027656457 7:80936193-80936215 ATAGGAAAATCTGTGGCCCAGGG - Intergenic
1027770032 7:82394778-82394800 ACAGAAGAAACAGAGGTTCAAGG + Intronic
1028419565 7:90617555-90617577 AGAGAGGAAACTGAGACCCAGGG + Intronic
1029958461 7:104664725-104664747 ACAGAAGATTCTGAGATCCAAGG - Intronic
1030069552 7:105687214-105687236 ACAGATGAATCTGTACCCCATGG + Intronic
1030096303 7:105903243-105903265 AAGGAAGAAACTGAGGCTCAGGG - Intronic
1030515615 7:110534254-110534276 CAAGAAGAAGGTGAGGCCCAGGG - Intergenic
1031980878 7:128123564-128123586 ACAGAGGGATAGGAGGCCCAGGG + Intergenic
1032535542 7:132660105-132660127 ACAGAAGGAACAGAGGCCCAGGG - Intronic
1035204917 7:157289110-157289132 ACAGAAATACCAGAGGCCCAGGG + Intergenic
1035310528 7:157964972-157964994 ACACAGGGATCTGAGGCACAAGG + Intronic
1035452409 7:158986027-158986049 ACAGTAGTTTTTGAGGCCCAAGG - Intergenic
1036451493 8:8871675-8871697 ACAGACGAAATTGAGGCCCAGGG + Intronic
1036581355 8:10078645-10078667 GCAGGAGAGGCTGAGGCCCACGG + Intronic
1037101960 8:15057743-15057765 AGTGAAAAAACTGAGGCCCAGGG - Intronic
1038045082 8:23759655-23759677 ACTGCAGAAACTGAGGCTCAGGG - Intergenic
1038229790 8:25689210-25689232 AGAGAGGAAACCGAGGCCCAGGG + Intergenic
1038337114 8:26654372-26654394 CCATAGGAATCTGTGGCCCAGGG - Intronic
1038447854 8:27616067-27616089 ATGGAAGAAACTGAGGCCCAAGG - Intergenic
1038649970 8:29393695-29393717 ACAGAAAAATGTGAGGGCGATGG - Intergenic
1039390972 8:37180516-37180538 TCAGAAGCTTCTGAGACCCAGGG - Intergenic
1040098215 8:43469636-43469658 ACAGAAAAATCTGAAGCACTTGG + Intergenic
1040592924 8:48811995-48812017 ACTGGACAATCTGAGGCTCAGGG - Intergenic
1042093775 8:65189334-65189356 ACAGCAGAAGCTGAGGCACATGG - Intergenic
1042893148 8:73635531-73635553 AAATAAAAATCTGAGGCCGAGGG + Intronic
1043305926 8:78795070-78795092 ACAGAAGAATCTGAGGCCCAGGG - Intronic
1043876739 8:85493948-85493970 AGAGAAGAAAATGAGCCCCAAGG - Intergenic
1044599684 8:93991412-93991434 AAAAAAGAATCTGAGGCTCAGGG + Intergenic
1044770718 8:95628772-95628794 ACACAAGAAGCTGAAGACCAGGG - Intergenic
1045460814 8:102424228-102424250 ACATAAGAATCTGAGGCTCAGGG + Intergenic
1046564818 8:115885718-115885740 AAAGAAGAAACTGAAGCACAAGG + Intergenic
1046691001 8:117284083-117284105 ACAGAAGAATCATAGGCACCTGG + Intergenic
1046908492 8:119600634-119600656 TGAGAAGAATCTGTGGCCCTGGG - Intronic
1047753536 8:127900635-127900657 ACCCAAGACTCTGTGGCCCAGGG - Intergenic
1048234262 8:132674962-132674984 GATGAAGAAGCTGAGGCCCAAGG + Intronic
1048822622 8:138393931-138393953 AAAGAAGAAACTGAGGCACGGGG - Intronic
1048967755 8:139626554-139626576 ACAGAAGAGAAAGAGGCCCAGGG - Intronic
1049012763 8:139898271-139898293 CCACAAGTATCTGAAGCCCAGGG - Intronic
1049197921 8:141325620-141325642 AATGAAGAAGCTGAGGCCCAGGG + Intergenic
1049462725 8:142737512-142737534 CCAGAAGGCTCTGAGGGCCAGGG + Intergenic
1050219719 9:3373525-3373547 GCTGAGGAAACTGAGGCCCAGGG - Intronic
1050769645 9:9181106-9181128 ACAAAAGAAACTGATGGCCAAGG - Intronic
1050953169 9:11623220-11623242 AATGAAGAAACTGAGGCCAAGGG - Intergenic
1051374716 9:16391405-16391427 ACAGAGGACACTGAGGCTCAGGG + Intergenic
1051486538 9:17614692-17614714 AATGGAGAAACTGAGGCCCAGGG + Intronic
1051707865 9:19899485-19899507 AAGGAAGAAGCTGAGGACCAAGG - Intergenic
1051761983 9:20477651-20477673 ATAGAAGAAACTAAGTCCCAGGG - Intronic
1052041945 9:23748798-23748820 ACAGAAGAGTCTACAGCCCAAGG + Intronic
1052672907 9:31581060-31581082 ACATCAGACTCTGAGCCCCAAGG + Intergenic
1052964590 9:34329930-34329952 ACAAGTGAAACTGAGGCCCAGGG - Intronic
1054924077 9:70571272-70571294 ATTGAAGAAACTGAGGCCCAGGG - Intronic
1055428689 9:76221485-76221507 AAACAAGAAACTGAGGCTCAGGG - Intronic
1056148211 9:83756360-83756382 ACTGGAGAAGCTGAGGCACAAGG + Intronic
1056419561 9:86410414-86410436 AAAGAGGAATGTGAAGCCCAGGG + Intergenic
1056667018 9:88589211-88589233 AGAGCAGACACTGAGGCCCAGGG - Intergenic
1056718478 9:89053509-89053531 AGAGAAGGAGCTGAGGCCCCAGG - Intronic
1056757502 9:89391128-89391150 AGAGCTGCATCTGAGGCCCAAGG + Intronic
1057640295 9:96813260-96813282 ACAGAAGAATAAAAGGCTCAAGG + Intergenic
1057858665 9:98622843-98622865 ACAGAAGAGTCTTAGGGCAATGG + Intronic
1057993931 9:99802083-99802105 ACAGAAGAATTCAAGGCCCTAGG + Intergenic
1058554900 9:106156744-106156766 TCAGGAGAAACTGAAGCCCAAGG + Intergenic
1058702745 9:107614389-107614411 GATGAAGAAACTGAGGCCCAGGG - Intergenic
1059123548 9:111662627-111662649 AAAGGAGAAACTGAGGCACAGGG - Intronic
1059279769 9:113122589-113122611 ACAGAAGAATAGGAGAGCCAGGG + Intergenic
1059366134 9:113787911-113787933 GCAGAGGAAACTGAGGCCCCAGG - Intergenic
1059981206 9:119773944-119773966 ACAAAAGAATCTGGAGACCAGGG - Intergenic
1060073028 9:120566818-120566840 ATAGGAGAAACTGAGGCCCAGGG - Intronic
1060117842 9:120958757-120958779 AGTGAAGAAACTGAGGCTCAGGG - Intronic
1060204720 9:121675718-121675740 AGAGCAGAAGCTGAGGCTCAGGG - Intronic
1060666531 9:125435369-125435391 GAAGAAGAAACTGAGGCTCAGGG + Intergenic
1060748044 9:126150673-126150695 ACAGAGAACTCTGAGGCCCCAGG + Intergenic
1061046420 9:128167504-128167526 TAAGAAGAAACTGAGGCCCAGGG + Intronic
1061178384 9:129010516-129010538 AGAGGGGAAACTGAGGCCCAGGG + Intronic
1061644319 9:131987905-131987927 ACTGGAGACTCTGAGGCCCAGGG - Intronic
1061766307 9:132883757-132883779 ACAGAAGAAAGCGAGGCCCTGGG - Intronic
1185587380 X:1249837-1249859 ACAGAAGAATGTGTGGCCACAGG + Intergenic
1186722857 X:12324021-12324043 ACATAAGAATCTGTGTGCCATGG + Intronic
1186836628 X:13444735-13444757 AGAGAAGTATCACAGGCCCAGGG - Intergenic
1187045339 X:15642744-15642766 AATGAAGAAACTGAGGCTCAGGG - Intronic
1187172266 X:16863643-16863665 AGTGAAGAAACTGAGGCCCCAGG - Intronic
1187586445 X:20667793-20667815 ACTGAGGAAACTGAGGCTCAGGG - Intergenic
1187953085 X:24490031-24490053 ACAGAATAGTCTGAGGCCATGGG - Intronic
1189163249 X:38832878-38832900 ACAGAAAACTCAGAGGCTCAAGG + Intergenic
1189199312 X:39178094-39178116 ACAGTAGAAGGTGAGGTCCAAGG - Intergenic
1189229056 X:39437768-39437790 ATAGAAGAGTCTGTGGCTCAAGG + Intergenic
1189294343 X:39908305-39908327 ACAGAGGAATCTGAGGCCCGGGG - Intergenic
1189311979 X:40025656-40025678 CCAGAACAGTCTGAGCCCCAGGG + Intergenic
1189973762 X:46442654-46442676 GGTGAAGAGTCTGAGGCCCAAGG - Intergenic
1191016539 X:55814819-55814841 ACAGAAAAAGTTGAAGCCCAAGG - Intergenic
1191128910 X:56987231-56987253 AGAGAAGAATCACAGGCCCTAGG + Intronic
1192734713 X:73839193-73839215 ACAGAAGACTGTGAGACCCAGGG - Intergenic
1192881969 X:75295198-75295220 ACCCAAGGATCTGAGGGCCAAGG - Intronic
1192981713 X:76351165-76351187 GCAGAAAAATCTGAGACTCAAGG - Intergenic
1194806794 X:98338959-98338981 GGTGAAGAAACTGAGGCCCAGGG + Intergenic
1196049408 X:111289202-111289224 AAAGAGTAAACTGAGGCCCAAGG - Intergenic
1196060556 X:111403653-111403675 AAAGAAGAAACTGAAGCCAAGGG - Intronic
1196720683 X:118850898-118850920 AGATAAGAAACTGAGGCTCAGGG - Intergenic
1197218844 X:123892511-123892533 AAACAAAAAGCTGAGGCCCAGGG - Intronic
1197896861 X:131325223-131325245 AAAGAAGAAACTGAAGGCCATGG + Intronic
1198685220 X:139221716-139221738 ACAGATGATTCTGAGGCTGAAGG + Intronic
1199848773 X:151710556-151710578 TCAGGAGAATCAGAGGCCGAAGG - Intergenic