ID: 1043305927

View in Genome Browser
Species Human (GRCh38)
Location 8:78795071-78795093
Sequence AACAGAAGAATCTGAGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 539
Summary {0: 1, 1: 0, 2: 3, 3: 55, 4: 480}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043305927_1043305933 24 Left 1043305927 8:78795071-78795093 CCTGGGCCTCAGATTCTTCTGTT 0: 1
1: 0
2: 3
3: 55
4: 480
Right 1043305933 8:78795118-78795140 CTTTCTCAAGGGCTGTTGTAAGG No data
1043305927_1043305931 12 Left 1043305927 8:78795071-78795093 CCTGGGCCTCAGATTCTTCTGTT 0: 1
1: 0
2: 3
3: 55
4: 480
Right 1043305931 8:78795106-78795128 TAGTAAGAGTGTCTTTCTCAAGG No data
1043305927_1043305932 13 Left 1043305927 8:78795071-78795093 CCTGGGCCTCAGATTCTTCTGTT 0: 1
1: 0
2: 3
3: 55
4: 480
Right 1043305932 8:78795107-78795129 AGTAAGAGTGTCTTTCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043305927 Original CRISPR AACAGAAGAATCTGAGGCCC AGG (reversed) Intronic
900697730 1:4022638-4022660 AACAAAGGAAACTGAGGCCCAGG - Intergenic
900890907 1:5449040-5449062 AACGGAAGAAGCTGGAGCCCGGG - Intergenic
901762771 1:11481305-11481327 AACAGAAGCTGCTGAGGCCACGG - Intronic
901784620 1:11616618-11616640 AAGAGAGGAAACTGAGGCACAGG + Intergenic
902992252 1:20196465-20196487 AAAAGAACGAGCTGAGGCCCAGG - Intergenic
903276131 1:22223113-22223135 AGGAGAAGAAACTGAGGCTCAGG - Intergenic
903382398 1:22906300-22906322 AAAAGAGGAAACTGAGGCACAGG + Intronic
903470083 1:23580740-23580762 AAAGGAAGAAACTGAGGCTCAGG - Intergenic
904081948 1:27877760-27877782 AGAAGAGGAAACTGAGGCCCAGG - Intronic
904093483 1:27960575-27960597 AGGCGAAGAAACTGAGGCCCAGG + Intronic
904211680 1:28889980-28890002 AATATCAGAATCTAAGGCCCTGG - Intronic
904274101 1:29369264-29369286 AGAAGAAGAAACTGAGGCTCAGG + Intergenic
904302247 1:29561824-29561846 ATCAGAGGAAACTGAGGCTCAGG + Intergenic
904401174 1:30257684-30257706 ATCAGAGGAAACTGAGGCTCAGG - Intergenic
904550783 1:31315645-31315667 AAATGAAGAATTTGAGGCTCAGG - Intronic
904862133 1:33546390-33546412 AACACAAAGATCTGAGGCCATGG + Intronic
905311273 1:37050871-37050893 AGATGAAGAAACTGAGGCCCTGG + Intergenic
905675671 1:39823252-39823274 AAAAGATGAAACTGAGGCACAGG + Intergenic
906581291 1:46937104-46937126 AATAGAAGAAGCTGAGCCTCAGG + Intronic
907982169 1:59494385-59494407 AACAGCAGGAGCAGAGGCCCAGG + Intronic
909234239 1:73131349-73131371 AACAATAGACTCTGAGGCCAAGG + Intergenic
909286717 1:73828990-73829012 GACAGAAGATTTTGAGGACCTGG - Intergenic
910337015 1:86145358-86145380 AACAAACAAATCTGAGGCCTTGG + Intronic
912504953 1:110150216-110150238 AAAAGAAGAAAGTGAGGCCCAGG + Intergenic
912516392 1:110219112-110219134 AGATGAAGAAACTGAGGCCCAGG - Intronic
912814666 1:112819486-112819508 AACAGAAGAGGCTGAGTCCTGGG - Intergenic
912957964 1:114169257-114169279 AACAGAATTTTCTGGGGCCCAGG - Intergenic
913074025 1:115325996-115326018 AATATAAGAGTCTGGGGCCCAGG + Intronic
913201989 1:116502385-116502407 TGCAGAAGAAGCTCAGGCCCGGG + Intergenic
913317687 1:117566397-117566419 AGCTGAAGAATCTGAGACTCAGG + Intergenic
913334570 1:117697285-117697307 GACTGAAGAATCAGAGGCCTGGG + Intergenic
915445239 1:155970805-155970827 AAGAGAAGGATCTTGGGCCCAGG - Intronic
915557831 1:156670071-156670093 GTCAGAAGAATTTGAGGACCTGG - Exonic
916059973 1:161091648-161091670 CACAGGAGAAACTGAGGCACAGG + Intergenic
916670505 1:167014451-167014473 GACAGGAGATTCTGAGGCCAAGG - Intronic
918198178 1:182242270-182242292 AACAGCACAATCTGATGCCGGGG + Intergenic
919458084 1:197843656-197843678 AAAAGAGGAAACTGAGGCACAGG - Intergenic
920544332 1:206802946-206802968 AACAGAAGCAGCTGTGGCCCTGG + Intronic
922183601 1:223255591-223255613 AACATAAGGCTCTAAGGCCCTGG - Intronic
922508244 1:226139971-226139993 ACCTGAAGAATCTGAGGAGCAGG + Intergenic
922749580 1:228064277-228064299 TAGAAAAGAAACTGAGGCCCAGG - Intergenic
923612724 1:235509764-235509786 AGCAGAAGAATCTGGGGCTGTGG - Intergenic
924954818 1:248916116-248916138 AAAAGCAGAATCTGTGGGCCGGG + Intronic
1063193964 10:3722859-3722881 AAATGAAGAATCAAAGGCCCAGG + Intergenic
1063721732 10:8589359-8589381 AAATGGAGAAACTGAGGCCCAGG - Intergenic
1064436008 10:15311747-15311769 AACAGAAGCACCTGAGGTCCAGG + Intronic
1065508172 10:26450675-26450697 AAAAAAAGAATCTGAGTTCCAGG - Intronic
1065656179 10:27952710-27952732 AACAGAAGACCCTTATGCCCAGG - Intronic
1066284470 10:33951121-33951143 AACAGAAAACTCTGTTGCCCAGG + Intergenic
1066298294 10:34075330-34075352 AACAGGACACTCAGAGGCCCAGG + Intergenic
1067157610 10:43795138-43795160 AAAGGAAGAACCTGAGGCTCAGG + Intergenic
1067797530 10:49331676-49331698 CACAGATGATTCTGAGGCCCAGG - Intergenic
1068119322 10:52770385-52770407 AACAGTCTAATGTGAGGCCCTGG - Intronic
1068653411 10:59549010-59549032 AAAAGAGGAAACTGAGGCCCAGG - Intergenic
1069571010 10:69494485-69494507 AAAAGAAGTAGCGGAGGCCCAGG + Intronic
1069596428 10:69674779-69674801 GACAGAAGTATATGATGCCCAGG - Intergenic
1069712546 10:70499369-70499391 TTCAGAAGAAGCTGGGGCCCAGG - Intronic
1069719249 10:70539340-70539362 AGATGGAGAATCTGAGGCCCCGG + Intronic
1069753286 10:70758405-70758427 AACTGAGGTATCTGAGGCTCAGG - Intronic
1069861771 10:71475945-71475967 AAGAGTGGAAACTGAGGCCCAGG - Intronic
1070341265 10:75500389-75500411 TACAGAAGAAACTGAGGCTGAGG + Intronic
1070517302 10:77220159-77220181 AAATGAAGAAACTGAGGCACAGG + Intronic
1070523729 10:77276936-77276958 AGCTGAGGAAACTGAGGCCCAGG + Intronic
1070751835 10:78968476-78968498 AGATGAAGAAACTGAGGCCCAGG + Intergenic
1071451089 10:85791956-85791978 AAGAGAAGCAGCTGAGTCCCTGG + Intronic
1073057103 10:100709937-100709959 AAGGGAAGAAACTGAGGCCCAGG + Intergenic
1073072940 10:100806206-100806228 AAGAGAAGGACCTGAGGACCTGG - Intronic
1073331276 10:102671373-102671395 AAGATAAGAAACTGAGGGCCAGG + Intergenic
1073488142 10:103834757-103834779 AGATGAAGAAACTGAGGCCCAGG + Intronic
1073622337 10:105062332-105062354 CAATGAAGAAACTGAGGCCCTGG - Intronic
1073626079 10:105098614-105098636 AGCAGAGGAAACTGAGGCACAGG - Intronic
1074845224 10:117391747-117391769 ATCAGTACAATCTGATGCCCTGG - Intergenic
1074975929 10:118581675-118581697 ATGAGAAGCATCTGAGACCCCGG + Intergenic
1078352265 11:10604074-10604096 ACCAGAAGAAACTGTGGCCCAGG - Intronic
1078844885 11:15111878-15111900 ACATGAAGAAACTGAGGCCCAGG - Intergenic
1079171039 11:18096105-18096127 AACTGAAAAATGGGAGGCCCAGG + Intronic
1079765358 11:24385751-24385773 AACCATAAAATCTGAGGCCCTGG + Intergenic
1079962967 11:26946565-26946587 AACAGAAGAATCAGAAGCTTAGG + Intergenic
1080410307 11:32017703-32017725 AGATGAAGAAACTGAGGCCCAGG + Intronic
1080512741 11:32991131-32991153 AAAAAAAGAATCTGAGGGCAAGG - Intronic
1081197747 11:40181859-40181881 AAGAGCAGACTCTGAGTCCCGGG - Intronic
1081235067 11:40637076-40637098 AACTAAAGAATCTGAGTGCCTGG - Intronic
1081618979 11:44607680-44607702 ATTTGAAGAAACTGAGGCCCAGG + Intronic
1081737438 11:45413895-45413917 CACTGAAGAAGCAGAGGCCCAGG + Intergenic
1081850527 11:46272353-46272375 CAGGGAAGAATCTGAGGCCCTGG + Intergenic
1082763740 11:57150120-57150142 AACAGCAGAATTAGAGGCCACGG + Intergenic
1083307126 11:61766999-61767021 CACAGAAGAAACTGAGGCCATGG - Intronic
1083428012 11:62599247-62599269 AGCAGAAGAACCTCAGCCCCAGG + Intronic
1083745599 11:64735036-64735058 CACACAAGAAACTGAAGCCCAGG + Intronic
1083746109 11:64737288-64737310 AACAGGAGAAACAGAGGCTCAGG + Intronic
1083851958 11:65373256-65373278 CACAGAGGAAACTGAGGCACAGG + Intergenic
1084250751 11:67896966-67896988 AACAAGTGAGTCTGAGGCCCAGG - Intergenic
1084822100 11:71699097-71699119 AACAAGTGAGTCTGAGGCCCAGG + Intergenic
1085359570 11:75874789-75874811 AACTGAAGATTCTGAGACACAGG + Intronic
1085380571 11:76113756-76113778 AAATGAAGAAACTAAGGCCCAGG - Intronic
1085708876 11:78811382-78811404 AAATTAAGAAACTGAGGCCCAGG - Intronic
1086677676 11:89629501-89629523 AGCAGAGGATTCAGAGGCCCTGG - Intergenic
1086869901 11:92025053-92025075 AAATGAAAAATCTGAGGCTCAGG + Intergenic
1088378154 11:109164148-109164170 AAGTTAAGAATCTGAGGCCAGGG + Intergenic
1089679929 11:120113665-120113687 AAAGGAAGAAACTGAGACCCAGG + Intronic
1090186675 11:124743606-124743628 AATTGAAGAATGTGAAGCCCAGG + Intronic
1091086772 11:132728345-132728367 CACTGGGGAATCTGAGGCCCTGG + Intronic
1091418231 12:310152-310174 AACAAGAGAAACTGAGGCTCAGG + Intronic
1091972168 12:4796708-4796730 AAGAGGGGAAACTGAGGCCCAGG + Intronic
1092028140 12:5260332-5260354 AGATGAAGAATCGGAGGCCCGGG + Intergenic
1092421003 12:8331752-8331774 AACAAGTGAGTCTGAGGCCCGGG - Intergenic
1093930696 12:24952355-24952377 CACAGAAGAATATGAGGGCCGGG + Intergenic
1094265730 12:28557414-28557436 AACTGAGGAAACTGAGGCACTGG - Intronic
1096349845 12:50888259-50888281 AACAAAAGAAAATGAGGGCCAGG + Intergenic
1096500590 12:52062014-52062036 AACAGCAGACTTTGAGGCCTTGG - Intergenic
1098217210 12:68233421-68233443 AACATAAGAATTTGAGGGCATGG - Intergenic
1098418230 12:70261822-70261844 AAAAAAAAAATCTCAGGCCCAGG - Intronic
1098654727 12:73013626-73013648 AACAAAAGAATCTGAAGAGCAGG - Intergenic
1100215503 12:92443628-92443650 GACAGAGAAATCTGAGGCACAGG + Intergenic
1100626118 12:96334054-96334076 AACAGCAGAATTTCAGGCACAGG + Intronic
1101004880 12:100391770-100391792 AGATGAAGAAACTGAGGCCCAGG - Intronic
1101325490 12:103711983-103712005 AAATGAAGAATCTGAGGCTTTGG - Intronic
1101793835 12:107954763-107954785 AAATGAGGAAACTGAGGCCCTGG - Intergenic
1101844444 12:108351281-108351303 AACATAAGCATCTGAGGAGCTGG + Intergenic
1102033435 12:109757908-109757930 CACAGACAAATCTGGGGCCCTGG + Intronic
1102237529 12:111303654-111303676 AAGAAAAGAAACTGAGACCCAGG + Intronic
1102415658 12:112760295-112760317 AAAAGAAGACAATGAGGCCCAGG - Intronic
1102747223 12:115259717-115259739 GACAGAAGAATCCTAGGCCCTGG - Intergenic
1104369260 12:128208567-128208589 AACTGAGGAAGCTGAGGCTCCGG + Intergenic
1104685827 12:130783400-130783422 AACAGAATATTCGGAGGCCAGGG + Intergenic
1104959888 12:132483686-132483708 CACACAAGTCTCTGAGGCCCGGG - Intergenic
1105648986 13:22352246-22352268 AACTGAAGCCTCTGAGGCCTGGG - Intergenic
1105680350 13:22719547-22719569 AACAGTAGAAACAGGGGCCCAGG - Intergenic
1106409244 13:29499401-29499423 AAAATAAGAATCTGAGATCCTGG - Intronic
1106677556 13:31977131-31977153 AACTGAGGAAACTGAGGCCTGGG - Intergenic
1109396962 13:61771879-61771901 AACACAATACTCTGAGGCCTTGG + Intergenic
1109773955 13:67015198-67015220 AACACAAGAGAGTGAGGCCCAGG - Intronic
1109848439 13:68028954-68028976 TACAGATAAATCTGAGGCTCAGG - Intergenic
1110044103 13:70807453-70807475 AACAGCTGAATCTAAAGCCCAGG - Intergenic
1110545190 13:76748161-76748183 AACTGAAGAATCTTATTCCCTGG + Intergenic
1110695265 13:78480711-78480733 AGCTGTAGAATCTGAGGTCCAGG + Intergenic
1111381657 13:87461923-87461945 AAAAGAAGGATCTGGAGCCCTGG - Intergenic
1111478020 13:88779826-88779848 ATTTGAAGAAACTGAGGCCCAGG + Intergenic
1112170078 13:96962292-96962314 AAAAGAAGCATCTGAGGTGCTGG + Intergenic
1112448584 13:99489433-99489455 AGCTGAAGAATTTCAGGCCCAGG + Intergenic
1113956549 13:114102596-114102618 AGGAGAAGATGCTGAGGCCCAGG + Intronic
1115242559 14:31264077-31264099 CAGAGAAGAAACTGAGGCCAAGG + Intergenic
1115416158 14:33136555-33136577 AACTGAAGAAACTGAGACCCTGG + Intronic
1117840637 14:59857156-59857178 AACTATAGAATCTGAGGCTCAGG + Intronic
1118491292 14:66263315-66263337 AGCATAAAAATCTGAGGCCTGGG - Intergenic
1118989528 14:70785161-70785183 AACAGAGGAAGCTGAGGCTCAGG - Intronic
1119319581 14:73721687-73721709 GACAGAAGAGTCTCAAGCCCTGG + Intronic
1119320826 14:73729362-73729384 TACTGAAAAAACTGAGGCCCAGG + Intronic
1119439938 14:74621444-74621466 AGATGAGGAATCTGAGGCCCAGG - Intergenic
1119476930 14:74935701-74935723 AAATGAAGGAGCTGAGGCCCAGG - Intergenic
1119511411 14:75214413-75214435 TAAAGAAGATTCTGAGGCCCTGG + Intergenic
1119559683 14:75579972-75579994 ACCAGAATAGTCTGATGCCCAGG - Intronic
1119938736 14:78617692-78617714 GACTGAAGAGACTGAGGCCCAGG - Intronic
1120787628 14:88551484-88551506 ACCAGTAGACTCGGAGGCCCCGG + Intronic
1122419872 14:101568829-101568851 AATGGTATAATCTGAGGCCCTGG + Intergenic
1122452390 14:101820302-101820324 AGCAGAAGAGTCTGTGGCACTGG - Intronic
1122883327 14:104699782-104699804 AGAAGAAGAAACTGAGGCCCAGG + Intronic
1122967414 14:105137847-105137869 AAAAGGGGAAACTGAGGCCCGGG - Intergenic
1125588400 15:40838618-40838640 ACCTGAAGAAAATGAGGCCCTGG - Intergenic
1126274926 15:46866036-46866058 AGCAAAAGAAACTGAGGCTCAGG - Intergenic
1126304319 15:47237787-47237809 GAGGGAAGATTCTGAGGCCCTGG + Intronic
1126359288 15:47829152-47829174 AAGAAATGAATCTGAGGTCCAGG + Intergenic
1126387995 15:48113545-48113567 ATCAGAGGAATCAGAGGCCCAGG + Intergenic
1127958149 15:63870912-63870934 AAAGGAGGAAACTGAGGCCCAGG + Intergenic
1128293454 15:66497160-66497182 CAAGGAAGAAACTGAGGCCCTGG - Intronic
1129185015 15:73900594-73900616 AGCAGCAGAGTCTCAGGCCCAGG + Intergenic
1129517907 15:76168051-76168073 AGAAGGAGAAACTGAGGCCCAGG + Intronic
1130847083 15:87757678-87757700 AAAACAAGAATCTGAGGCTCAGG + Intergenic
1130926254 15:88388008-88388030 AACATAAGACTCTGAGGGGCTGG - Intergenic
1131429833 15:92377897-92377919 GACAGAGAAAGCTGAGGCCCAGG + Intergenic
1131468163 15:92672449-92672471 AATCGAGGAAACTGAGGCCCAGG - Intronic
1132259382 15:100408904-100408926 AAGAGAGGAAACTGAGGCTCAGG + Intronic
1132768387 16:1546738-1546760 GACAGCAGACCCTGAGGCCCGGG - Intronic
1132861411 16:2073549-2073571 ACCATCAGAAGCTGAGGCCCGGG - Intronic
1134071366 16:11261968-11261990 ATGACAAGAATGTGAGGCCCTGG + Intronic
1134468559 16:14500965-14500987 AGCAGAAGAATCTGTAGCCATGG - Intronic
1135915929 16:26605432-26605454 AGCTGAAGAAACTGAGGCACAGG - Intergenic
1136142875 16:28298517-28298539 GTCAGAGGAAACTGAGGCCCAGG - Intronic
1136366377 16:29811045-29811067 GACAGAAGAAGTTGTGGCCCTGG + Exonic
1136513543 16:30753951-30753973 ATCAGGTGAACCTGAGGCCCAGG - Intronic
1137709552 16:50556634-50556656 AGCTGGAGAATCTGAAGCCCAGG - Intronic
1137880835 16:52046682-52046704 AACAGGAGACTCTTAGACCCTGG - Intronic
1138334735 16:56244255-56244277 AGAGGAAGAAACTGAGGCCCAGG - Intronic
1138443399 16:57048110-57048132 AGATGAAGAAGCTGAGGCCCGGG - Intronic
1138561574 16:57803628-57803650 TCCAGAACAATCTGAGGCCCAGG - Intronic
1140035537 16:71368644-71368666 GACAGAAGACACTGAGGCACAGG - Intronic
1140105147 16:71952924-71952946 AACAGAAGCATCTGAGAGGCAGG + Exonic
1140254214 16:73321014-73321036 AACAGAGGGATCTGACCCCCAGG + Intergenic
1141046344 16:80719249-80719271 AACTGAAGATTCCCAGGCCCCGG + Intronic
1141058677 16:80843276-80843298 AACAGGAGACTCTGAGCACCTGG + Intergenic
1141639607 16:85333587-85333609 AGAGGAAGAAACTGAGGCCCAGG - Intergenic
1141803557 16:86327344-86327366 AGAAGAAGAAACTGAGGCTCAGG - Intergenic
1141809484 16:86365353-86365375 AGAGGAAGAAACTGAGGCCCAGG - Intergenic
1141889247 16:86915539-86915561 AACAGAGGAAGCTGAGGCTCGGG - Intergenic
1142015461 16:87743981-87744003 AACATTAGAATTTGAGGGCCAGG + Intronic
1142032601 16:87845981-87846003 CACAGAAGAATGGCAGGCCCAGG + Intronic
1142042427 16:87903130-87903152 ACCAGAAGAAACTCAGGCCTCGG + Intronic
1143099281 17:4496610-4496632 CAATGAAGAAACTGAGGCCCAGG - Intergenic
1143733400 17:8894100-8894122 CCCAGGAGAAACTGAGGCCCAGG - Intronic
1144590890 17:16522785-16522807 AAGAGAAGACTCTCAGGTCCTGG + Intergenic
1144765467 17:17730230-17730252 AACGGAAGCATTTCAGGCCCTGG - Intronic
1144892201 17:18500591-18500613 AGATGAAGAAACTGAGGCCCAGG + Intergenic
1144951776 17:18998309-18998331 AAGTGAAGAAACTGAGGCCGAGG + Intronic
1145140015 17:20443697-20443719 AGATGAAGAAACTGAGGCCCAGG - Intergenic
1146509070 17:33430212-33430234 AAGAGAAGGCACTGAGGCCCAGG - Intronic
1146589636 17:34117617-34117639 AACAGAAGATGCTGAAGTCCTGG + Intronic
1146931589 17:36782052-36782074 ATCTGAAGAATCTGAGGCCCAGG + Intergenic
1147339161 17:39743617-39743639 AATAGAAGAAACTGATGCTCAGG - Intronic
1147539007 17:41341147-41341169 AACTGAAGAATCTGAGCTCGAGG - Intergenic
1147967574 17:44201207-44201229 AACAGAGGAAACTGAGGCACAGG - Intergenic
1149584287 17:57774980-57775002 AACAGAAGAGGCTGAGGTGCTGG - Intergenic
1149686574 17:58538964-58538986 ATCAGAGGAATCAGAGGCCTTGG + Intronic
1151199638 17:72458203-72458225 CAAAGGAGAAACTGAGGCCCGGG + Intergenic
1152821255 17:82439022-82439044 AGCTGAAGAAACTGAGGCACGGG + Intronic
1153012451 18:551415-551437 AGCAGAAGGCTCTGAGGTCCTGG - Intergenic
1153613206 18:6908766-6908788 CAGACAAGAAGCTGAGGCCCAGG - Intronic
1154317364 18:13315276-13315298 AACAGGAGAACTGGAGGCCCTGG - Intronic
1155040163 18:22058482-22058504 AAATGAAGAAACTGAGACCCAGG - Intergenic
1156087594 18:33425421-33425443 AAAAAGAGAATCTGAGGCCAAGG - Intronic
1156561741 18:38133395-38133417 AACAGCAGAAAATGAGGTCCAGG + Intergenic
1156747034 18:40404772-40404794 AACAGAAGATTCTGAGGGAGAGG - Intergenic
1157515348 18:48307180-48307202 AGTAGTAGAAACTGAGGCCCTGG - Intronic
1157866554 18:51191770-51191792 AAAAGAGGAATCTGAAGCCTAGG + Intronic
1158213501 18:55075993-55076015 AACTGATGAAACTGAGGCACAGG + Intergenic
1158215252 18:55094201-55094223 AGCAGGAGATTCAGAGGCCCAGG - Intergenic
1158375575 18:56859424-56859446 TAAAGAAGAACCTGAGGCACGGG - Intronic
1158443155 18:57495246-57495268 AAAAGAGAAATCTGAGGCTCAGG + Intergenic
1159323770 18:66889383-66889405 AACAAAAGGATGTGAGTCCCTGG - Intergenic
1159447469 18:68558269-68558291 AACAGAAAAGGCTCAGGCCCAGG + Intergenic
1159555788 18:69943094-69943116 AACAGAAGACACTGAGGTTCAGG - Intronic
1160286525 18:77548410-77548432 ATCAGAAGGATCTGAGATCCAGG - Intergenic
1160605786 18:80048702-80048724 AAATAAGGAATCTGAGGCCCAGG + Intronic
1160703991 19:520877-520899 AACAGGAGACACTGAGGCCAAGG - Intergenic
1160763212 19:796117-796139 AGCTGGAGAAACTGAGGCCCGGG - Intergenic
1160943081 19:1629176-1629198 AACAGAGGAAACTGAGGCTCAGG - Intronic
1161529043 19:4776052-4776074 AGGAGAGGAAACTGAGGCCCAGG + Intergenic
1161953339 19:7479484-7479506 AAGAAAAGAATCAGAAGCCCTGG + Intronic
1162214059 19:9117631-9117653 AACAGAGGAATCTCAGTCCTAGG + Intergenic
1162230593 19:9262721-9262743 AACAGAGGAAACTGAGGGCCGGG - Intergenic
1162495464 19:11020998-11021020 AAGGGAGGAAACTGAGGCCCAGG + Intronic
1162530219 19:11231642-11231664 AAATGAAGAAACTGAGGCTCAGG + Intronic
1162642737 19:12024601-12024623 AACAAAAGAAGCTGAGGCAGAGG + Intronic
1162795691 19:13086449-13086471 AACTGAGGAAACTGAGGCTCTGG - Intronic
1162926962 19:13935674-13935696 CACAGATGTATCTGAGGCCTGGG + Intronic
1163257434 19:16165306-16165328 AAAAAAAGGAACTGAGGCCCTGG + Intronic
1163753297 19:19091579-19091601 AACAGAAGAATGTTATGGCCGGG + Intronic
1165449703 19:35874917-35874939 AAGAGAAGAGCCTGAGGCGCGGG - Intronic
1165827784 19:38715016-38715038 AAGTGAGGAAACTGAGGCCCAGG + Intronic
1165949651 19:39466900-39466922 AGCAGAAGAAACTGAGGCACAGG - Intronic
1166647748 19:44544730-44544752 AAATGAAGAACCTGAGGCTCAGG + Intergenic
1166812131 19:45521070-45521092 GACAGGAGAAGCTAAGGCCCGGG - Intronic
1166963390 19:46513480-46513502 AACAGCGGAATCAGAGTCCCTGG - Intronic
1166987097 19:46667405-46667427 AGAATAAGAATCTGGGGCCCGGG + Intergenic
1167378948 19:49127720-49127742 CACAGAAGAAACTGAGGCCCAGG - Intronic
1167508270 19:49882467-49882489 CAAAGAGGAAACTGAGGCCCAGG - Intronic
925476754 2:4225486-4225508 TACAGAAGGAACTGAGGTCCAGG + Intergenic
925720505 2:6822156-6822178 AAGGGAAGAATCTGGAGCCCAGG - Intergenic
925731864 2:6924713-6924735 ACCACAAGAATCTCTGGCCCTGG - Intronic
925760609 2:7180962-7180984 AACTGAAGAATCAGAGGCCGAGG - Intergenic
925854309 2:8115293-8115315 AAATGAAGAAACTGAGGCCCAGG - Intergenic
925865953 2:8225944-8225966 AGCAGATGAAGCAGAGGCCCAGG + Intergenic
925920858 2:8636899-8636921 AACAGAAGGAGCAGAGGCCGCGG - Intergenic
926632044 2:15145579-15145601 AAGAGGAGCATCTGAGTCCCAGG + Intergenic
926853782 2:17229863-17229885 AGCAAAAGAGTCTGAGACCCAGG - Intergenic
927785497 2:25971477-25971499 AACAGAAGAGTCCCAGGCCCTGG - Intronic
927927132 2:27021686-27021708 AACAGAAAAATCTGCTCCCCGGG + Intronic
927945152 2:27131171-27131193 AACAGCGGTATCTGAAGCCCAGG - Exonic
928922628 2:36541429-36541451 TACAGAAGAAACTGAGGCTCAGG + Intronic
928982888 2:37154855-37154877 AACAGAAGAAAACCAGGCCCAGG - Intronic
929046866 2:37798750-37798772 ACTAGAAGAATCTTAGGGCCTGG - Intergenic
929631628 2:43468883-43468905 AGATGAAGAAACTGAGGCCCGGG + Intronic
931809286 2:65838913-65838935 AACACAACAATTAGAGGCCCAGG + Intergenic
932209111 2:69913260-69913282 ACGTGAAGAAACTGAGGCCCAGG - Intronic
933060386 2:77729352-77729374 AACAAAGAAATCTGAGTCCCTGG - Intergenic
934944740 2:98531659-98531681 AACAGAAAAAACAGAGGCCTAGG + Intronic
935051588 2:99529342-99529364 AGCCGAGGACTCTGAGGCCCAGG - Intergenic
935813759 2:106826922-106826944 ATCAGAACAATCGGAGGCCAGGG + Intronic
936440554 2:112548316-112548338 AGCAGAGGAAACTGAGGCTCAGG - Intronic
937821133 2:126312321-126312343 AACAGTAGAGACTGAGGCCTGGG + Intergenic
938669326 2:133572048-133572070 AACCAAGGAAACTGAGGCCCAGG + Intergenic
938748769 2:134308047-134308069 TACAGAAGACACTGAGGCCCAGG - Intronic
938961162 2:136342906-136342928 ACCTGAAGATTGTGAGGCCCAGG - Intergenic
940353629 2:152717047-152717069 AAGAGAAGGATGTGAGACCCTGG - Intronic
941015708 2:160353751-160353773 AACTGAAAAAGCTGAGGCTCAGG - Intronic
941448403 2:165629363-165629385 AACAGCAGATTCTGCAGCCCTGG + Intronic
942089682 2:172477766-172477788 AAATGAGGAAACTGAGGCCCAGG + Intronic
942212890 2:173689253-173689275 CACAGAAGGAACTAAGGCCCAGG + Intergenic
942227453 2:173829801-173829823 AAATGGAGAAACTGAGGCCCAGG - Intergenic
943365827 2:186966840-186966862 TACAGAATAAACTGAGGCTCAGG - Intergenic
944911643 2:204316087-204316109 AAGAGAAAAATCTAAGGTCCTGG + Intergenic
945371750 2:209027025-209027047 AACCAAAGAATCTGATACCCTGG - Intergenic
945410461 2:209500371-209500393 AACAGAAGAATCAAAGCCCAGGG - Intronic
945616251 2:212071990-212072012 AGAAGAAGAAACTGAGGCTCAGG + Intronic
946157910 2:217818924-217818946 AGAAGAAGAAACTGAGGCTCAGG + Intronic
947689783 2:232124008-232124030 CACTGAATAATCTGAGGCCTAGG - Intronic
949077715 2:242071701-242071723 AAAAGAGGAAACTGAGGCACAGG - Intergenic
1168820457 20:769427-769449 AAGAGAAGACTCTGAAGCACAGG - Intergenic
1169267679 20:4176631-4176653 AGAAGAAGAAACTGAGGCCCAGG + Intronic
1169841499 20:9943182-9943204 AACAGAGGTTTCTGGGGCCCTGG - Intergenic
1171841951 20:30224395-30224417 AACAGAGTAATTTGAGGCCCTGG + Intergenic
1173059185 20:39645497-39645519 AACAGAGGAAACTGTGACCCTGG - Intergenic
1173274089 20:41564085-41564107 AAATGAAGAAACTGAGACCCAGG - Intronic
1173785037 20:45786792-45786814 AACATAAGAATCTCAGGAGCAGG + Intronic
1173812463 20:45964375-45964397 CACAGAACAATCTAAGGCTCGGG + Intronic
1173968541 20:47132539-47132561 AGCTGAAGAAACTGAGGCCCAGG + Intronic
1174368941 20:50073387-50073409 CCCTGAAGAATCTGAGGCACAGG + Intergenic
1174390456 20:50215806-50215828 CACACAAGAATCTGAGACCAGGG + Intergenic
1175087878 20:56476207-56476229 GACAGTAAAATCTGAGGCCACGG - Intronic
1175920793 20:62449825-62449847 GACAGAAGAGTCTTGGGCCCCGG + Intergenic
1177321075 21:19521785-19521807 CTCAGAGGAATCTGAAGCCCTGG - Intergenic
1177964612 21:27712364-27712386 AACAGAAGCATTTCAGGCCATGG + Intergenic
1178591284 21:33913110-33913132 AAAAGGGGAAACTGAGGCCCTGG - Intronic
1179887975 21:44322539-44322561 CACAGAAGGGTCTCAGGCCCTGG - Intronic
1179951232 21:44709814-44709836 TACAGAACGATCTGAAGCCCTGG + Intronic
1180960154 22:19758914-19758936 AACAGAGGACGCTGCGGCCCTGG + Intronic
1181164377 22:20975632-20975654 AGCAGAAGACACTGGGGCCCAGG - Intronic
1181991629 22:26841436-26841458 AAATGGAGAAACTGAGGCCCGGG + Intergenic
1182040808 22:27237602-27237624 AGAAGAAAAATCTCAGGCCCTGG + Intergenic
1182043347 22:27255409-27255431 AACTGAGAAAACTGAGGCCCTGG + Intergenic
1182097891 22:27638282-27638304 AGCAGAGGAAACTGAGGCTCAGG - Intergenic
1182446641 22:30393488-30393510 CCCAGAAGAATCTGAAGCACAGG + Intronic
1183016217 22:34989904-34989926 AACATATGAACCTGTGGCCCAGG - Intergenic
1183405008 22:37626092-37626114 AACTGAGGAAACTGAGGCTCGGG + Intronic
1183669913 22:39266418-39266440 CACAGGGGAAGCTGAGGCCCAGG + Intergenic
1184262234 22:43325144-43325166 CACAGAAGAGGCTGAGGCTCAGG + Intronic
1184297215 22:43532414-43532436 AGAAGGAGAAACTGAGGCCCAGG + Intronic
1184387022 22:44182168-44182190 AGGTGAAGAAACTGAGGCCCTGG + Intronic
949506113 3:4729227-4729249 AGCAGAAGAAACTGAGGCACAGG - Intronic
949717777 3:6953196-6953218 AACAAAAAATTCTGAGGCACTGG - Intronic
950276347 3:11664573-11664595 GAGAGAAGAATCTGGGGACCAGG + Intronic
950640454 3:14345129-14345151 AAGAGAGGAAACTGAGGCCCAGG - Intergenic
951349943 3:21594456-21594478 AACAGAATGATTTCAGGCCCAGG + Intronic
951611968 3:24499531-24499553 GGTAGAAGATTCTGAGGCCCTGG + Intergenic
952084655 3:29803108-29803130 AAATGAAGAAGCTGAGGCTCAGG + Intronic
952290424 3:32009948-32009970 AGCATATGAATCTGAGGCACTGG - Intronic
953389075 3:42524187-42524209 AACTGCAGGCTCTGAGGCCCTGG - Intronic
953469691 3:43156053-43156075 AAATAAAGAAACTGAGGCCCAGG + Intergenic
954436116 3:50497259-50497281 AAGAAAGGAAACTGAGGCCCAGG + Intronic
954810506 3:53244368-53244390 AAGTGAAGAAGCTGAGCCCCGGG - Intronic
954833036 3:53439361-53439383 AAAAGAAGAATATGAGAGCCAGG - Intergenic
955029911 3:55205860-55205882 AAGAAATGAATCGGAGGCCCAGG - Intergenic
955095313 3:55790992-55791014 AGAAGAGGAAGCTGAGGCCCAGG - Intronic
955743536 3:62118108-62118130 GACTGAAGAATCTGAGGCTTAGG + Intronic
956068653 3:65423729-65423751 AGAAGAGGAAGCTGAGGCCCAGG - Intronic
956428742 3:69163672-69163694 TAGAGAGGAAACTGAGGCCCAGG + Intergenic
956536103 3:70278799-70278821 AGAAGAAGAATCTGAGGCATAGG - Intergenic
957064964 3:75514307-75514329 AACAAGTGAGTCTGAGGCCCAGG - Intergenic
957396931 3:79652535-79652557 AACAGAAGAATCTATCGCACAGG + Intronic
959096895 3:101965990-101966012 AAAAGAATAATCTGAGGCAGAGG - Intergenic
959097537 3:101971948-101971970 AAAAGAATAATCTGAGGCAGAGG - Intergenic
960202057 3:114848761-114848783 AGCAAAAGAATCTGCTGCCCAGG + Intronic
961288380 3:125825089-125825111 AACAAGTGAGTCTGAGGCCCAGG + Intergenic
961602618 3:128073036-128073058 AGGTGAAGAAACTGAGGCCCAGG + Intronic
961813321 3:129534213-129534235 AGGAGAAGAAAGTGAGGCCCAGG - Exonic
963005552 3:140723515-140723537 CACAGCAGAAGCTGAGGCCTGGG - Intergenic
964017387 3:151964096-151964118 AATAGAAAATGCTGAGGCCCAGG - Intergenic
964329662 3:155588379-155588401 AACAGAAGAAAATGAGACTCAGG - Intronic
964928817 3:161990349-161990371 AATAGAAGTCTCTGAGGCCCTGG + Intergenic
965612184 3:170556111-170556133 AAAAGAAGAAACTGAAGCCCAGG - Intronic
966504869 3:180688181-180688203 AACTGAAGAATATGGGGCCCTGG - Intronic
966513039 3:180785304-180785326 AAAAAAAGAATTTGAGGGCCAGG + Intronic
966613428 3:181890555-181890577 AAATGAAGAAACAGAGGCCCAGG + Intergenic
966807745 3:183819768-183819790 TTCAGAAGAAACTGAGGCTCAGG - Intronic
966861802 3:184234674-184234696 CTCAGCAGAATATGAGGCCCGGG + Exonic
967284314 3:187853609-187853631 AACTGGAGAAACTGAAGCCCAGG + Intergenic
968313661 3:197704442-197704464 AAAAGAAAAATAGGAGGCCCTGG + Intronic
968964232 4:3761443-3761465 GACAGGGGAAACTGAGGCCCTGG + Intergenic
969500612 4:7550362-7550384 AGAAGCAGAAACTGAGGCCCTGG - Intronic
969804098 4:9592982-9593004 AACAAGTGAGTCTGAGGCCCAGG + Intergenic
970028291 4:11647860-11647882 GACAGAAGATTTTGAGGCTCTGG - Intergenic
970464228 4:16306933-16306955 AAAAAAAGAAACTGAGACCCAGG + Intergenic
970991505 4:22218508-22218530 ACCAGAACAATCAAAGGCCCAGG + Intergenic
972139688 4:35942271-35942293 AACAGGAAAATCTGAGGCAGAGG + Intergenic
972672056 4:41221946-41221968 AACAGAGGAAACTGAGGCCAAGG + Intergenic
972717197 4:41658150-41658172 AAGTGAAGAAACTGAGGCCCGGG - Intronic
972743660 4:41912287-41912309 AAGAAAATAATCTGAGGCACTGG - Intergenic
973116975 4:46473737-46473759 AACTGAAGAATCTGAGGTTCAGG + Intronic
976100940 4:81562560-81562582 AAATGAAGAAACTGAGGCCTAGG + Intronic
976115826 4:81725113-81725135 AACAGAAGACTTTCAAGCCCTGG + Intronic
976774015 4:88687245-88687267 AACAGAAGAAGCTGATACCTGGG + Exonic
976831254 4:89317347-89317369 CACAGAAGACTCAAAGGCCCTGG + Intergenic
977636943 4:99310005-99310027 AGCAGAAGAATCTAAGACTCTGG + Intronic
978861894 4:113460224-113460246 TACAGAAAAATCTGTGACCCAGG - Exonic
980492738 4:133550461-133550483 TACAGAAAAATCTGATGACCAGG - Intergenic
980749608 4:137071028-137071050 AACACAAGACTCTGGGGCCTGGG + Intergenic
981336286 4:143572438-143572460 AATGGAGGAGTCTGAGGCCCTGG + Intergenic
981584009 4:146280881-146280903 AACCAAGGAAACTGAGGCCCAGG + Intronic
981991196 4:150922885-150922907 AGAAGAAGAATCTGAGGCAGGGG + Intronic
983514910 4:168645562-168645584 GAAAGAGGAAACTGAGGCCCAGG - Intronic
984280533 4:177664873-177664895 AACAGATGAAACGGAGGTCCAGG + Intergenic
984904248 4:184611958-184611980 AAAAGACTCATCTGAGGCCCTGG - Intergenic
985032325 4:185801847-185801869 AAAAGAAGAAACTGAGGCTCAGG - Intronic
989419520 5:41220297-41220319 AAAAGGAGAATCTAAGGCTCTGG + Intronic
990087962 5:52002302-52002324 AACACAAGAATCTATGGCCTTGG - Intergenic
990116198 5:52394394-52394416 AAAAGAAGAATCTGAGGCAAAGG + Intergenic
990483020 5:56229840-56229862 AACAGAGGGGACTGAGGCCCAGG - Intronic
992163763 5:74028162-74028184 AACAGAAAAATCACAGGCTCTGG + Intergenic
992565087 5:77988250-77988272 ACAAGAAGAACCCGAGGCCCCGG + Intergenic
992583827 5:78211833-78211855 AACAGAATTATCTGATGCCCAGG - Intronic
993539906 5:89136253-89136275 AAAAGAAATATCTGAAGCCCAGG - Intergenic
994196964 5:96932541-96932563 AACAGAAAACTCTGAAGCACTGG + Intronic
997871516 5:137509638-137509660 AAGAGAAGAAACTGAGTCCTAGG - Intronic
998170277 5:139868655-139868677 AAAAGGAGAAACTGAGGCCCGGG - Intronic
998370315 5:141656492-141656514 AGGAGAAGAAAGTGAGGCCCTGG - Exonic
998681932 5:144477595-144477617 CAGAGAAGAATCTAAAGCCCAGG - Exonic
999298334 5:150474534-150474556 AAATGGAGAAACTGAGGCCCAGG - Intergenic
999369905 5:151048409-151048431 TACAGAGGAAACTGAGGCCTAGG + Intronic
999828689 5:155298802-155298824 CACTGAGGAAACTGAGGCCCAGG - Intergenic
1001162837 5:169336550-169336572 TACAGCAGAACCTGAGTCCCTGG - Intergenic
1001304096 5:170558932-170558954 AGGTGAAGAAACTGAGGCCCTGG - Intronic
1001608725 5:172983052-172983074 AGTTGAAGAAACTGAGGCCCAGG - Intergenic
1001707192 5:173750072-173750094 AACATATGAATTTGAGGCCAGGG - Intergenic
1001781479 5:174372545-174372567 AACTGAAGAAACTGAGGCTCAGG - Intergenic
1002912058 6:1498035-1498057 ACCAGCAGGATCTGAGGCCAGGG - Intergenic
1002933315 6:1650048-1650070 AGCTGAAGAAACTGAGGCCGTGG - Intronic
1003334003 6:5153544-5153566 AAAAGAGGAAACTGAGGCTCTGG - Intronic
1003718437 6:8673639-8673661 AACATATGAATCTGGGGCCAAGG - Intergenic
1004025121 6:11810722-11810744 AAGAGAAGAAGCTGGGACCCAGG - Intergenic
1005586450 6:27280739-27280761 AAGGGAAGAAACTGAGGGCCCGG + Intergenic
1006247918 6:32756555-32756577 AACAGAGGATGCTGAGGTCCAGG + Intronic
1006449044 6:34095469-34095491 AGCTGAAGAAACTGAGGCCGGGG - Intronic
1006934586 6:37708438-37708460 CACAGAAGAATCTGGGACCCAGG - Intergenic
1006944469 6:37776261-37776283 CACAGAAGACTCAGAGGACCGGG - Intergenic
1007760396 6:44129903-44129925 AAATGAAGAAACTGAGGCCCAGG + Intronic
1008426425 6:51363358-51363380 AAATGAAGAAACTGAGGTCCAGG - Intergenic
1008490322 6:52079610-52079632 AAATGAACAATCTGAGGCTCAGG - Intronic
1010572480 6:77494633-77494655 AAAGGAAGAAACTGAGGCACAGG - Intergenic
1012509931 6:99991509-99991531 AAATGAAGCATCTGAGGCCGGGG + Intronic
1012855489 6:104496567-104496589 ATGAGAAGACTCTGAGGCCTTGG - Intergenic
1014155571 6:118105330-118105352 AAGTGAAGGATCTAAGGCCCAGG - Intronic
1014238877 6:118992359-118992381 AACACATGAATCTGAGGCTAAGG - Intronic
1014489561 6:122045403-122045425 AACAGAAGAATCTGACTCTTTGG + Intergenic
1016628818 6:146203383-146203405 AACAGAGGACTCTAATGCCCTGG - Intronic
1017234346 6:152104027-152104049 AAGTCAAGAAACTGAGGCCCAGG - Intronic
1017382135 6:153843311-153843333 AATGGAAGGATCTGAAGCCCAGG - Intergenic
1017787411 6:157768038-157768060 AAAACAAGAGTCTCAGGCCCAGG + Intronic
1018431280 6:163724686-163724708 TACAAAAGAAACTAAGGCCCGGG - Intergenic
1019339680 7:503126-503148 TACAGAACAAACTGAGGCGCAGG + Intronic
1019799636 7:3078736-3078758 AACAGAACAAGCTGTGGCCTGGG + Intergenic
1020034064 7:4953228-4953250 CACAGAAGAATGTGAGCTCCAGG + Intronic
1021164950 7:17326124-17326146 AATAGAAGAAACTGAGGTCAAGG - Intronic
1021605515 7:22405653-22405675 AAGTGAGGAAACTGAGGCCCAGG - Intergenic
1021764072 7:23929316-23929338 AAATGAGGAAACTGAGGCCCAGG + Intergenic
1022097299 7:27148837-27148859 CACAGAAGACGCAGAGGCCCTGG + Intronic
1022546445 7:31193533-31193555 TTCACAAGAAACTGAGGCCCAGG + Intergenic
1022711201 7:32852736-32852758 AAATGAAGAAACTGAGGCTCTGG + Intergenic
1022740225 7:33113238-33113260 AACAGCAAAATCTGAGGCCAAGG - Intergenic
1022944355 7:35266981-35267003 TTTAGAAGAATCTGAGGCTCTGG + Intergenic
1023567347 7:41536693-41536715 AAGAGGAGAATCTGAGGCAGAGG + Intergenic
1024384559 7:48736939-48736961 AACAAAAAAAACTAAGGCCCAGG + Intergenic
1025027939 7:55533609-55533631 ATCTGAAGAAGCTGAGGCTCAGG - Intronic
1025142986 7:56480968-56480990 AGCAGAAAAAACTGAGGTCCTGG + Intergenic
1026050623 7:66943580-66943602 ACATGAAGAAACTGAGGCCCAGG - Intronic
1026810788 7:73462921-73462943 AACATCAGAATTTGAAGCCCGGG - Exonic
1027159422 7:75791482-75791504 CACAGAGGAATCTGGAGCCCAGG - Intergenic
1028193381 7:87876863-87876885 AAGAAAAGAAGCTGAGGACCCGG - Intronic
1029315930 7:99713800-99713822 GACAGAAGAATAAAAGGCCCAGG - Intronic
1030096304 7:105903244-105903266 AAAGGAAGAAACTGAGGCTCAGG - Intronic
1030366750 7:108655400-108655422 ACTAGAAGAATGTGAGGTCCTGG + Intergenic
1031292460 7:119954296-119954318 AGATCAAGAATCTGAGGCCCTGG - Intergenic
1032535543 7:132660106-132660128 TACAGAAGGAACAGAGGCCCAGG - Intronic
1032540040 7:132695188-132695210 AAGTGAGGAAACTGAGGCCCAGG - Intronic
1032835763 7:135671888-135671910 AAAAGAGGAACTTGAGGCCCAGG - Intronic
1033415338 7:141156869-141156891 AACAGATGCATCTGAAACCCAGG - Intronic
1034308574 7:150067484-150067506 CACAGTAAAATCTCAGGCCCTGG + Intergenic
1035425871 7:158772701-158772723 ATAACAAGCATCTGAGGCCCTGG - Intronic
1035536248 8:393497-393519 AAAAGAGGAAACTGAGGCACAGG - Intergenic
1036366545 8:8125295-8125317 AACAAGTGAGTCTGAGGCCCAGG + Intergenic
1036451492 8:8871674-8871696 TACAGACGAAATTGAGGCCCAGG + Intronic
1036884344 8:12540347-12540369 AACAAGTGAGTCTGAGGCCCAGG - Intergenic
1037815326 8:22108946-22108968 AGAAGAGGAAACTGAGGCCCGGG - Intronic
1037939321 8:22939854-22939876 AAAAGAAGAATTTGTGTCCCTGG - Intronic
1038012828 8:23488211-23488233 AAGTGGAGAAACTGAGGCCCCGG + Intergenic
1040517060 8:48143984-48144006 GACACAAGAATCTGAAGGCCAGG + Intergenic
1043305927 8:78795071-78795093 AACAGAAGAATCTGAGGCCCAGG - Intronic
1044599683 8:93991411-93991433 CAAAAAAGAATCTGAGGCTCAGG + Intergenic
1045363996 8:101458889-101458911 AACAGAAGACACTTAGGCCTAGG + Intergenic
1045460813 8:102424227-102424249 CACATAAGAATCTGAGGCTCAGG + Intergenic
1046908493 8:119600635-119600657 CTGAGAAGAATCTGTGGCCCTGG - Intronic
1047212948 8:122854394-122854416 GATAGGAGAAACTGAGGCCCAGG + Intronic
1047753537 8:127900636-127900658 AACCCAAGACTCTGTGGCCCAGG - Intergenic
1048173201 8:132128265-132128287 AAATGAAGAATCTTAGGCTCAGG - Exonic
1048822623 8:138393932-138393954 AAAAGAAGAAACTGAGGCACGGG - Intronic
1048908289 8:139109724-139109746 ATCAGAAGATTCTGAAGACCAGG + Intergenic
1049116296 8:140690919-140690941 AAATGAAGAAATTGAGGCCCAGG - Intronic
1049197920 8:141325619-141325641 GAATGAAGAAGCTGAGGCCCAGG + Intergenic
1049769531 8:144373517-144373539 AACCCCAGAATCTGAAGCCCTGG + Intronic
1050019491 9:1268624-1268646 CCCTGAAGAATCTGAGCCCCTGG - Intergenic
1050133814 9:2441008-2441030 AACAAAAGAATCTGAGCAGCAGG - Intergenic
1050601543 9:7258013-7258035 AACAAAAGAATCTGATGCTGAGG - Intergenic
1050665622 9:7933236-7933258 AGAAGAAGACTCTGAGGCTCAGG + Intergenic
1050773269 9:9230510-9230532 ATCAGAAGTATGGGAGGCCCAGG + Intronic
1050953170 9:11623221-11623243 AAATGAAGAAACTGAGGCCAAGG - Intergenic
1051348327 9:16172672-16172694 AGTTGAAGAAACTGAGGCCCAGG + Intergenic
1051374715 9:16391404-16391426 AACAGAGGACACTGAGGCTCAGG + Intergenic
1052216088 9:25967040-25967062 AACATCAGAAACTGAAGCCCAGG + Intergenic
1052964591 9:34329931-34329953 AACAAGTGAAACTGAGGCCCAGG - Intronic
1054924078 9:70571273-70571295 AATTGAAGAAACTGAGGCCCAGG - Intronic
1056419560 9:86410413-86410435 AAAAGAGGAATGTGAAGCCCAGG + Intergenic
1057154349 9:92827419-92827441 AAAGGAAGAATCTGAGGTCAAGG + Intergenic
1057929155 9:99178742-99178764 AGGAGAAGAAACGGAGGCCCTGG + Intergenic
1058702746 9:107614390-107614412 AGATGAAGAAACTGAGGCCCAGG - Intergenic
1059279768 9:113122588-113122610 AACAGAAGAATAGGAGAGCCAGG + Intergenic
1059391834 9:114004235-114004257 CAGAGAGAAATCTGAGGCCCAGG + Intronic
1059440426 9:114303732-114303754 AACAGCAAAAGCTGAGGCCTGGG - Intronic
1059981207 9:119773945-119773967 AACAAAAGAATCTGGAGACCAGG - Intergenic
1060073029 9:120566819-120566841 TATAGGAGAAACTGAGGCCCAGG - Intronic
1060333202 9:122694654-122694676 CACAGAAGATTCCGATGCCCAGG + Intergenic
1060666530 9:125435368-125435390 AGAAGAAGAAACTGAGGCTCAGG + Intergenic
1061046419 9:128167503-128167525 CTAAGAAGAAACTGAGGCCCAGG + Intronic
1061051680 9:128200082-128200104 AAAAGAAGAATCTCAGGGCCAGG - Intronic
1061421906 9:130477256-130477278 AGCTGAGGAAACTGAGGCCCAGG - Intronic
1061644320 9:131987906-131987928 AACTGGAGACTCTGAGGCCCAGG - Intronic
1061766308 9:132883758-132883780 CACAGAAGAAAGCGAGGCCCTGG - Intronic
1061808996 9:133151665-133151687 GACAGCAGACTCTGAGGCCTGGG - Intergenic
1185784376 X:2877444-2877466 GACAGAAGAATCAGAGGCAGGGG - Intronic
1186468258 X:9801402-9801424 AACAGCAGAAGATGAGGCCAGGG - Intronic
1187045340 X:15642745-15642767 AAATGAAGAAACTGAGGCTCAGG - Intronic
1187173329 X:16871368-16871390 AATAGAAGAAAATGAGGGCCAGG + Intergenic
1187229199 X:17404653-17404675 AACAGAAGAATCTTAGAACTGGG - Intronic
1187586446 X:20667794-20667816 AACTGAGGAAACTGAGGCTCAGG - Intergenic
1187953086 X:24490032-24490054 AACAGAATAGTCTGAGGCCATGG - Intronic
1189294344 X:39908306-39908328 CACAGAGGAATCTGAGGCCCGGG - Intergenic
1189920584 X:45899758-45899780 AACAGAAGAAAATGAGGAACAGG + Intergenic
1191201015 X:57781563-57781585 AACAGAACAATCAGAGACACTGG - Intergenic
1192170327 X:68850879-68850901 CAAAGAAGCAGCTGAGGCCCAGG + Intergenic
1192217155 X:69168126-69168148 AACAGAAGGATCTGAGGATCTGG - Intergenic
1192734714 X:73839194-73839216 TACAGAAGACTGTGAGACCCAGG - Intergenic
1192809028 X:74533433-74533455 AACAGGAGAATCTGGGCCCTAGG + Exonic
1193180670 X:78452603-78452625 AACAGAAAAATCTGAGGAAAAGG - Intergenic
1194325203 X:92506834-92506856 AACAGAAAAATCCCAGGACCAGG - Intronic
1194806793 X:98338958-98338980 AGGTGAAGAAACTGAGGCCCAGG + Intergenic
1195895004 X:109736984-109737006 TACAGAAGAGGCTGAGGCTCAGG - Intergenic
1196157562 X:112447898-112447920 AGATGAAGAATCTGAGGCTCAGG - Intergenic
1196416340 X:115475764-115475786 GACAGAAGAAGGTGGGGCCCTGG - Intergenic
1197338331 X:125235089-125235111 AAGAGCAGAAAGTGAGGCCCTGG - Intergenic
1198031848 X:132760833-132760855 AAAAAAGGAATTTGAGGCCCGGG + Intronic
1198706395 X:139453260-139453282 TACAGAAGAGTCTGAGGCTAGGG - Intergenic
1200633932 Y:5626027-5626049 AACAGAAAAATCCCAGGACCAGG - Intronic