ID: 1043305928

View in Genome Browser
Species Human (GRCh38)
Location 8:78795077-78795099
Sequence TTTCACAACAGAAGAATCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1032
Summary {0: 1, 1: 1, 2: 5, 3: 99, 4: 926}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043305928_1043305933 18 Left 1043305928 8:78795077-78795099 CCTCAGATTCTTCTGTTGTGAAA 0: 1
1: 1
2: 5
3: 99
4: 926
Right 1043305933 8:78795118-78795140 CTTTCTCAAGGGCTGTTGTAAGG No data
1043305928_1043305932 7 Left 1043305928 8:78795077-78795099 CCTCAGATTCTTCTGTTGTGAAA 0: 1
1: 1
2: 5
3: 99
4: 926
Right 1043305932 8:78795107-78795129 AGTAAGAGTGTCTTTCTCAAGGG No data
1043305928_1043305931 6 Left 1043305928 8:78795077-78795099 CCTCAGATTCTTCTGTTGTGAAA 0: 1
1: 1
2: 5
3: 99
4: 926
Right 1043305931 8:78795106-78795128 TAGTAAGAGTGTCTTTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043305928 Original CRISPR TTTCACAACAGAAGAATCTG AGG (reversed) Intronic
900605553 1:3522066-3522088 TTTCGCCACAGAAGATGCTGGGG - Intronic
900866248 1:5270605-5270627 TTTCACAAGAAGAGAATGTGGGG - Intergenic
901202709 1:7475771-7475793 TTTCATAGAAGAAGAAACTGAGG + Intronic
901460569 1:9388843-9388865 TTTTACAGCAGGAGAAGCTGAGG + Intergenic
901659000 1:10787150-10787172 TTTGACAAGAGAGGAAACTGAGG + Intronic
901733019 1:11294189-11294211 TTTCATAAGAGAGGAAACTGAGG + Intronic
901799087 1:11697095-11697117 TTTTACAAGAGAGGAAACTGGGG + Intronic
901952692 1:12761249-12761271 TTTCACAAGAGGGGAAACTGAGG + Exonic
902089949 1:13895006-13895028 TTTTACAAAAGAGGAAACTGAGG - Intergenic
902208025 1:14884033-14884055 TTTCACAGATGAAGAAACTGAGG + Intronic
902365076 1:15967792-15967814 TTTTACAACTGAGGAAACTGAGG + Intronic
902548006 1:17202277-17202299 TTTTACAGCAAAAGAAACTGAGG - Intergenic
902664680 1:17929247-17929269 TTTCACAAAAGACGAAACTGGGG - Intergenic
902743297 1:18455490-18455512 TTTTACAAATGAAGAAACTGAGG + Intergenic
902793289 1:18783898-18783920 TTTTACAGCTGAAGAAACTGAGG - Intergenic
902933608 1:19748275-19748297 TTTGACAAAAGAGGAAACTGAGG - Intronic
903301262 1:22380195-22380217 TTTCACAGATGAAGAAACTGAGG - Intergenic
903842263 1:26251848-26251870 TTACAAAACAGAAGACTGTGAGG - Intronic
903956505 1:27029707-27029729 TTTCACAGGTGAAGAAACTGAGG + Intergenic
904012531 1:27398033-27398055 TTTTACAAAAGAAGAAGTTGAGG + Intergenic
904093014 1:27958257-27958279 TTTCACAAATGAGGAAACTGAGG - Intronic
904302246 1:29561818-29561840 TTTTACATCAGAGGAAACTGAGG + Intergenic
904401175 1:30257690-30257712 TTTTACATCAGAGGAAACTGAGG - Intergenic
904403362 1:30271378-30271400 TTTCACAGATGAGGAATCTGAGG - Intergenic
904500995 1:30912832-30912854 TTTCACAGCTGGGGAATCTGGGG + Intergenic
904540154 1:31227428-31227450 TTTCACCGAAGCAGAATCTGAGG - Intronic
904541210 1:31234593-31234615 TTTTACAAAGGAAGAAACTGTGG + Intronic
904603274 1:31685068-31685090 TTTGACAGCTGAAGAAACTGAGG - Intronic
904623985 1:31791926-31791948 TCTCATAGAAGAAGAATCTGAGG - Intronic
904693996 1:32317119-32317141 CTTTACAAAAGAAGAATCTGAGG - Intronic
904918369 1:33986441-33986463 TTTTACAGCTGAAGAAACTGAGG + Intronic
905267809 1:36766829-36766851 TTTCACAAATGAGGAAACTGAGG - Intergenic
905274509 1:36808259-36808281 TTCTACAACAGGAGAATCTGGGG - Intronic
905344690 1:37303298-37303320 TTTCACAGAGGAAGAAACTGAGG + Intergenic
905396994 1:37673118-37673140 TTGCACAGGAGAAGAAACTGAGG + Intergenic
905451053 1:38056612-38056634 TTTTACAAATGAAGAAACTGAGG + Intergenic
905453953 1:38074898-38074920 TTTTACAAATGAAGAAACTGGGG + Intergenic
905480580 1:38259198-38259220 TTTCACAGATGAAGAAACTGAGG - Intergenic
905984190 1:42262355-42262377 TTTCATAAAAGAAGAAACTAAGG - Intronic
906172470 1:43738845-43738867 TTTCACAACATAACAGTCTTTGG - Intronic
906697803 1:47836443-47836465 TTGCACAAAAGAAGGAACTGGGG - Intronic
906952617 1:50347067-50347089 TTTCACAGGTGAAGAAACTGAGG - Intergenic
906970161 1:50504884-50504906 TGTCACAAAAGGAGAATCTTGGG + Intronic
907072001 1:51544155-51544177 TTTCACAGATGAAGAAACTGAGG + Intergenic
907275191 1:53313127-53313149 CTTCACAGCAGAGGAAGCTGAGG + Intronic
907355455 1:53869466-53869488 TTTCACCAATGAAGAATCTGAGG + Intronic
907550895 1:55303925-55303947 TTTTACAAATGAAGAAACTGAGG - Intergenic
907643710 1:56219385-56219407 TTTTACAAATGAAGAAACTGAGG + Intergenic
907783353 1:57587721-57587743 TTTCACAATTGAAGACACTGAGG + Intronic
907789066 1:57643921-57643943 TTTCACAACTGAGAAAACTGAGG + Intronic
907883538 1:58573077-58573099 TTTCAGAACAGAAGCATGAGGGG + Intergenic
908035872 1:60052457-60052479 TTTCACAAAGGAAGAATGAGAGG - Intronic
908097028 1:60749826-60749848 TTTCTAAACAAATGAATCTGGGG - Intergenic
908151323 1:61305729-61305751 TTTAACAGAAGAAGACTCTGAGG + Intronic
908360717 1:63366760-63366782 TTTCACAGTTGAAGAAACTGAGG + Intergenic
908619391 1:65960565-65960587 TTTCACAGATGATGAATCTGAGG - Intronic
908654627 1:66374984-66375006 TTTGACACATGAAGAATCTGAGG + Intergenic
908784205 1:67718987-67719009 TTTTACAAACGAAGAAACTGAGG + Intronic
908861435 1:68494593-68494615 TTTCACAGCAGGAGAAGCAGTGG - Exonic
909162928 1:72177182-72177204 TTTCACAAATGAAGAAACTGAGG + Intronic
909504198 1:76369482-76369504 TTTCACCAAGGAAGAAGCTGAGG + Intronic
909554952 1:76943206-76943228 TTTTACAAGTGAAGAAACTGAGG + Intronic
909762902 1:79315035-79315057 TTTTACAAAAGGAGAAACTGAGG + Intergenic
910340877 1:86185592-86185614 TTGCACAACATAAGAGTCTAAGG - Intergenic
910727286 1:90352337-90352359 TTTTACAGCTGAAGAAACTGAGG + Intergenic
910729634 1:90380463-90380485 TTTTACAAAAGAAGAAACTAAGG - Intergenic
911039991 1:93583763-93583785 TTTCACAGCTGAGGAAACTGAGG - Intronic
911114445 1:94231891-94231913 TTTCACAAATGAGGAACCTGAGG + Intronic
911539804 1:99144980-99145002 GTTAACAACTTAAGAATCTGAGG + Intergenic
911686640 1:100784652-100784674 TTTAACAACATAAGAATGTATGG - Intergenic
913114254 1:115682015-115682037 GTTTACAAAAGAAGAAACTGAGG - Intronic
913170064 1:116223787-116223809 TTTTACAAATGAAGAAACTGAGG - Intergenic
915298094 1:154936010-154936032 TTTCACAGGTGAAGAAACTGAGG - Intronic
915846033 1:159266186-159266208 TTTTACAAATGAAGAAACTGAGG + Intergenic
916128367 1:161590935-161590957 TTTCACAAATGAGGAAACTGAGG + Intronic
916240686 1:162635817-162635839 TTTCACATCAGAATCACCTGGGG - Intronic
916493541 1:165324772-165324794 TTTTACAAATGAAGAAACTGAGG + Intronic
916857208 1:168762216-168762238 CTTCACAACAGAAGAAACTGAGG - Intergenic
916868028 1:168881842-168881864 TTTTACAGCAGAGGAAGCTGAGG - Intergenic
916883560 1:169045782-169045804 TTTCACAAATGAAGAAACTAAGG - Intergenic
916902385 1:169243095-169243117 TTTCAAAAAAGAAAAATGTGAGG + Intronic
916954648 1:169819565-169819587 TTTCACTAAAAAAGGATCTGTGG + Intronic
917137670 1:171803218-171803240 TTGCACAACAAAACCATCTGGGG + Intronic
917217764 1:172695893-172695915 TTTTACAAATGAAGAAACTGAGG + Intergenic
917545621 1:175964107-175964129 TTTCACAGAAGAGGAAACTGAGG + Intronic
917595681 1:176526864-176526886 TTTCACAGGGGAAGAATCTCTGG - Intronic
918081686 1:181212648-181212670 TTTTACAACTGAGGAAACTGAGG + Intergenic
918552078 1:185754972-185754994 TTTCACACATGAAGAAACTGAGG - Intronic
919096806 1:193047030-193047052 TTTCACAAATGAAGAAATTGAGG - Intronic
919137518 1:193529358-193529380 TCTCACTACAGAAGTGTCTGGGG + Intergenic
919458085 1:197843662-197843684 TTTCACAAAAGAGGAAACTGAGG - Intergenic
919569161 1:199224024-199224046 TTTCACAAACGAGGAAACTGGGG + Intergenic
919861707 1:201743085-201743107 TTTCACAGATGAAGAAACTGAGG + Intronic
920089591 1:203442799-203442821 TCTCAAAACAGAGGGATCTGGGG - Intergenic
920207347 1:204302184-204302206 TGTTACAAATGAAGAATCTGAGG + Intronic
920387021 1:205576442-205576464 TTTTACAGCAGAGGAAACTGAGG + Intronic
921215060 1:212929573-212929595 TTTTACAAAAGAAGAAACTGAGG - Intergenic
921236345 1:213135527-213135549 TTTTAAAACAGAAAAAGCTGTGG - Intronic
921364801 1:214363680-214363702 TTTCACAGAAGAGGAAACTGAGG - Intronic
921512114 1:216044803-216044825 TTTTACAAGTGAAGAAACTGAGG - Intronic
921532078 1:216296719-216296741 CTTCATAAAAGAAGAATATGTGG + Intronic
922235833 1:223721803-223721825 TTTCACAGAAGAAGAAACTGAGG - Intronic
922273516 1:224055988-224056010 TTTTACAAATGAAGAAACTGAGG + Intergenic
922343534 1:224677099-224677121 TTTCAGAGAAGAAGAAACTGAGG - Intronic
922737982 1:227999632-227999654 TTTCCCAACAGGAAAGTCTGGGG + Intergenic
922761726 1:228136940-228136962 TTTCACACCAGTAGCTTCTGTGG + Intergenic
922974880 1:229776102-229776124 TTTTATAACTGAAGAAACTGAGG + Intergenic
923043578 1:230337487-230337509 TTTCCAAACTGAAGCATCTGGGG - Intronic
923223969 1:231922441-231922463 TTTCACAGATGAAGAATGTGAGG + Intronic
923418480 1:233789129-233789151 TTTTACAAATGAAGAAACTGAGG - Intergenic
923495876 1:234524032-234524054 TTGCAGAACACCAGAATCTGGGG - Intergenic
923501664 1:234570486-234570508 TTTCACAAAGGAAGAAACTGAGG + Intergenic
923581586 1:235221208-235221230 TTTTACAAATGAAGAAACTGAGG + Intronic
923606686 1:235450329-235450351 TTTCTCAACAGGACAGTCTGTGG - Exonic
923612725 1:235509770-235509792 GGTCAAAGCAGAAGAATCTGGGG - Intergenic
923648004 1:235844386-235844408 TTTCTCAACTGTAGAATGTGGGG - Intronic
923824081 1:237479865-237479887 ATTTACAAATGAAGAATCTGAGG + Intronic
923893776 1:238245578-238245600 TTTCCCAACAGCAGATCCTGTGG - Intergenic
924863600 1:247953500-247953522 TTTCTCATCACAAGAAGCTGTGG + Intronic
1063041152 10:2338496-2338518 TTTCTCAAAAGAAGAATGTTGGG - Intergenic
1063505253 10:6591969-6591991 TTTTACAGCAGAGGAAACTGAGG - Intergenic
1064480299 10:15733978-15734000 TTTCCACACAGAAGAATTTGAGG + Intergenic
1065062548 10:21919582-21919604 TTTCAAACTAGAAGAATTTGAGG + Intronic
1065110545 10:22436538-22436560 TGTCACAATAGAGGAAACTGAGG + Intronic
1065771626 10:29083555-29083577 TTTCAGTGCAGGAGAATCTGAGG - Intergenic
1066045823 10:31594841-31594863 TTTCCTAAAAGCAGAATCTGAGG - Intergenic
1066692975 10:38050050-38050072 ATTCACTACTGAAGCATCTGGGG - Intronic
1067358719 10:45556666-45556688 TTCCACAAAAGAGGCATCTGGGG + Intronic
1068021428 10:51590276-51590298 TTGCACAAGTGAAGAAACTGAGG + Intronic
1068504280 10:57879738-57879760 TTTTACAGATGAAGAATCTGAGG - Intergenic
1068567226 10:58589352-58589374 TTTCACATAAGAGGAAACTGAGG + Intronic
1068653412 10:59549016-59549038 TTTTACAAAAGAGGAAACTGAGG - Intergenic
1068852963 10:61765497-61765519 TTTCACAACAGAAGCTTCCTGGG + Intronic
1068928291 10:62562595-62562617 TTTCACACGTGAGGAATCTGAGG + Intronic
1068935832 10:62634961-62634983 TTTTACAGCTGAAGAAACTGAGG - Intronic
1069502004 10:68961859-68961881 TTTAACAAAAGAAAAATCTGAGG - Intronic
1069620494 10:69834596-69834618 TTTCAAAAATGAAGAAACTGAGG + Intronic
1069880285 10:71588382-71588404 TTTCACAGATGAAGAAACTGAGG - Intronic
1069989711 10:72307609-72307631 TTTTACCACAAAAAAATCTGGGG - Intergenic
1070074439 10:73121367-73121389 TAGCACTGCAGAAGAATCTGAGG + Intronic
1070417315 10:76203245-76203267 TTTTACAAGTGAAGAAGCTGAGG - Intronic
1070668226 10:78360355-78360377 TTTTACAGTGGAAGAATCTGAGG - Intergenic
1070977502 10:80616984-80617006 TTTCACAAATGAGGAAGCTGAGG + Intronic
1071026800 10:81124257-81124279 CTTCATAACAGAAGGGTCTGAGG - Intergenic
1071693847 10:87851514-87851536 TTTTACAAATGAAGAAACTGAGG - Intergenic
1071781380 10:88849575-88849597 TTTTACAAATGAAGAAACTGAGG - Intronic
1072443223 10:95475845-95475867 TTTCACAAATGAAGAAAATGAGG + Intronic
1072705853 10:97680392-97680414 TTTCACAGATGAGGAATCTGAGG + Intronic
1072734554 10:97870017-97870039 TTTAACAACTGGGGAATCTGAGG - Exonic
1072739327 10:97900295-97900317 AGTCTCAACAGAAAAATCTGTGG + Intronic
1072766382 10:98098074-98098096 TTTCACAGATGAAGAAACTGAGG + Intergenic
1073328076 10:102654000-102654022 TTTCACAGAAGAGGAAACTGAGG - Intronic
1073444559 10:103572808-103572830 TTTCACAGCTGAGGAAGCTGAGG - Intronic
1073554338 10:104434105-104434127 TTTCACAGCAGAGGAAACAGAGG - Intronic
1073604705 10:104882558-104882580 TTTTACAAGTGAAGAACCTGAGG + Intronic
1073639759 10:105239967-105239989 TTTCCCAGCACAAGAGTCTGTGG + Intronic
1073659484 10:105458529-105458551 TTTCACAGATGAGGAATCTGAGG + Intergenic
1073713719 10:106076722-106076744 TTTCACAAATGGAGAAACTGGGG - Intergenic
1073809491 10:107137029-107137051 TTCACCAACAGAAGAATCTGGGG + Intronic
1074383890 10:113001995-113002017 TTTCACAGATGAAGAAACTGAGG - Intronic
1074410314 10:113222542-113222564 TTTGACATCAGAAGCTTCTGGGG - Intergenic
1075051808 10:119187773-119187795 TTTCACACCTGCAGAAACTGAGG - Intergenic
1075298094 10:121295784-121295806 TGTCAGAGCAGAAGAATGTGAGG + Intergenic
1075841786 10:125510968-125510990 TTTCACATTAGAAGACACTGTGG - Intergenic
1075890186 10:125942055-125942077 TTTCACATCAGAAGGGTGTGTGG - Intronic
1076349433 10:129805715-129805737 TTTTTCAAAGGAAGAATCTGTGG + Intergenic
1076365377 10:129918332-129918354 TTTCACTGAAGAAGAAACTGAGG + Intronic
1077949536 11:6941049-6941071 TTTCAAAACATAAAATTCTGAGG - Intronic
1078066175 11:8080976-8080998 TTTCACAGAAGACGAAACTGAGG + Intronic
1078412753 11:11141056-11141078 TTTTACAAACGAAGAAACTGAGG + Intergenic
1078762516 11:14262570-14262592 TTTTACAGAAGAAGAAACTGAGG - Intronic
1078779214 11:14421272-14421294 TTTTACAACTGAAGAAACTGAGG - Intergenic
1078898577 11:15620730-15620752 TTACACATCAGAACATTCTGGGG + Intergenic
1079017643 11:16882991-16883013 TTTCACAAAAGAGGAAACTGAGG + Intronic
1079523193 11:21353360-21353382 TTTCACAAGTGAGGAAACTGAGG + Intronic
1079614413 11:22473025-22473047 TTTAACAAGAGAGGAACCTGTGG + Intergenic
1079734581 11:23980084-23980106 TTTCTCACCAGAAGTTTCTGAGG + Intergenic
1080026566 11:27621368-27621390 TTTCAAATCAGGAGAATCTTTGG + Intergenic
1080245332 11:30173595-30173617 TTTTACAAGGGAAGATTCTGAGG - Intergenic
1080396767 11:31897442-31897464 TTTCACAGATGAAGAAACTGAGG + Intronic
1081130658 11:39375510-39375532 TTTTACAGAAGAAGAAACTGAGG + Intergenic
1081532411 11:43971435-43971457 TTTCACAGAAGAGGAAACTGAGG + Intergenic
1081577694 11:44329564-44329586 TTTAACAAAAGAGGAAACTGAGG + Intergenic
1081671087 11:44943107-44943129 TTTCACAAGAGGGGAAACTGAGG - Intronic
1082033067 11:47620795-47620817 TTTCACATATGAAGAAACTGGGG - Intronic
1082109771 11:48261597-48261619 TGTCACAGAAGAGGAATCTGGGG - Intergenic
1082909320 11:58352558-58352580 TTTCACAAATGAGGAAACTGAGG - Intergenic
1083049489 11:59764395-59764417 TGTCACAAATGAAGAAACTGAGG + Intronic
1083172480 11:60931167-60931189 TTTCACAAGTGAAGAAACTGAGG - Intronic
1083269326 11:61563496-61563518 TTTCACAGGAGAAGAAACTAAGG + Intronic
1083295972 11:61715895-61715917 TTTTACAAGAGAAGAAACTGAGG + Intronic
1083498479 11:63080683-63080705 TTTCACACCAGAAGGTTCAGTGG - Intronic
1083892698 11:65604585-65604607 TTTTACAACAGAGAAAACTGAGG - Intronic
1084153641 11:67302612-67302634 TTTTACAACTGAAGAAACTGAGG - Intergenic
1084425972 11:69084815-69084837 TTGCACAGCAGAGGAAACTGAGG + Intronic
1084451288 11:69240370-69240392 TTTTACAGCAGAGGAAACTGAGG + Intergenic
1084578305 11:70005277-70005299 TTTTACAAGTGAAGAAGCTGGGG + Intergenic
1084720278 11:70901384-70901406 TTTCACCATAGAAGATTCTGTGG - Intronic
1084960766 11:72715155-72715177 TTTCACAGAAGAGGAAACTGAGG - Intronic
1085198004 11:74683764-74683786 TTTTACAGCAGAGGAACCTGGGG + Intergenic
1085822866 11:79811719-79811741 TTTCATAAAAGAGGAATCTGAGG - Intergenic
1086179246 11:83930660-83930682 TTTACCCACAGAAGAGTCTGAGG - Intronic
1086320544 11:85642631-85642653 TTTAACATCTGTAGAATCTGTGG - Intergenic
1086500329 11:87446408-87446430 TTTTACAAAAGAGGAAACTGAGG - Intergenic
1086683018 11:89698058-89698080 TTTCACAGAGGAAGAAACTGAGG - Intergenic
1086878030 11:92121189-92121211 TTTCAAAACAAAAGTCTCTGGGG - Intergenic
1087046717 11:93849472-93849494 TTTCACAAGTGAGGAAACTGAGG - Intronic
1087101131 11:94365706-94365728 TTTCTCTACAGAAGTATCTGAGG - Intergenic
1088000265 11:104871091-104871113 TATCAGAAGAGAAGAATCTGTGG + Intergenic
1088335660 11:108700737-108700759 TTTTACCAGAGAAGAAACTGAGG - Intronic
1088464113 11:110115220-110115242 TTCCACTACTGAAGAAACTGAGG - Intronic
1088471644 11:110193698-110193720 TTTTACAGCAGAGGAATCGGAGG + Intronic
1088720352 11:112586774-112586796 TTTCCCAAAAGAAAAGTCTGTGG + Intergenic
1089344009 11:117778500-117778522 TTTCATAAATGAAGAAACTGGGG - Intronic
1089388815 11:118086140-118086162 TTTCACAAATGGAGAAACTGAGG - Intronic
1089751441 11:120654275-120654297 TTTCACAAATGAGGAAGCTGAGG - Intronic
1089780594 11:120870691-120870713 TTTCACGAATGAAGAAACTGAGG - Intronic
1089893350 11:121903245-121903267 TTTCACAGCTGAAGAAACTGAGG - Intergenic
1090173723 11:124627932-124627954 TTTTGAAAAAGAAGAATCTGTGG + Intronic
1090500921 11:127260063-127260085 TTTTACAAATGAAGAAACTGGGG + Intergenic
1090916272 11:131165787-131165809 CTACACAACACAAGGATCTGGGG - Intergenic
1091100450 11:132868144-132868166 TTTCACAAATGAAGAAACTGAGG + Intronic
1091607900 12:1972560-1972582 TTTCACCAATGAGGAATCTGTGG + Intronic
1091723145 12:2827690-2827712 TTTGAAAACAGAAGAGGCTGAGG + Intronic
1091928479 12:4375100-4375122 TTTCACAGCTGAGGAAACTGAGG - Intronic
1092294484 12:7187495-7187517 TTTTACAAAAGAGGAAACTGAGG - Intergenic
1093137543 12:15470341-15470363 ATTCACAGAAGAAGAAACTGAGG - Intronic
1093233948 12:16583381-16583403 TTACAGAACAGAAAAATCTTGGG + Intronic
1093548812 12:20382230-20382252 ATTCTCAACAGAAGCAACTGAGG - Intronic
1093759740 12:22895234-22895256 TTTCATAATTGAAGAAACTGAGG - Intergenic
1094068096 12:26382914-26382936 TTTTACAAATGAAGAAACTGAGG + Intronic
1094753130 12:33437758-33437780 TATCACCACAGAGGACTCTGAGG + Intronic
1095263097 12:40120837-40120859 TTTCAAAACAGAAGAATGAATGG - Intergenic
1095655372 12:44662490-44662512 TTTCACAAATGAAGAAACTGAGG - Intronic
1095730738 12:45504334-45504356 TTTTACAAATGAAGAAACTGAGG + Intergenic
1095805713 12:46318085-46318107 TTTCACAAATGAACAAACTGAGG - Intergenic
1095886063 12:47189846-47189868 CTTCCAAACAGAAGACTCTGGGG + Intronic
1095969005 12:47888692-47888714 TTTTACAACTGAAGAAACGGAGG + Intronic
1095990484 12:48030857-48030879 TTTCACAGTAGAGGAAACTGAGG + Intergenic
1096239665 12:49953069-49953091 TTTCACAGAAGGAGAAACTGAGG + Intronic
1096393885 12:51250685-51250707 TTTCACAAATCAAGAAACTGAGG - Intronic
1096470368 12:51871802-51871824 TTTCACAGATGAAGAAACTGAGG - Intergenic
1096521016 12:52184606-52184628 TTTCACACAGGAAGAAACTGAGG + Intronic
1097347646 12:58512207-58512229 TTTCACAGCTGAGGAAACTGAGG - Intergenic
1098025484 12:66196417-66196439 TTTAACAAGGGAAGAATGTGTGG + Intronic
1098462425 12:70746536-70746558 TTTACCAACATAAGAAACTGTGG - Intronic
1098592910 12:72235354-72235376 TTTCACAAGTGAAAAAACTGAGG + Intronic
1098868382 12:75787805-75787827 ATTCACAACAGCAGCATGTGAGG + Intergenic
1099296890 12:80839333-80839355 TTTTACAAATGAAGAAACTGAGG - Intronic
1099946460 12:89250213-89250235 TTTGAGAACAGAATCATCTGAGG + Intergenic
1100180050 12:92075256-92075278 TCTCACAAGAAAAGTATCTGAGG - Intronic
1100361741 12:93885654-93885676 TTTTTCAAAAGAAGAAACTGAGG - Intronic
1100578246 12:95913235-95913257 TTTCACAAATGAGGAAGCTGAGG - Intronic
1100775993 12:97975378-97975400 TTTTACAAAAGAGGAAACTGAGG - Intergenic
1101004881 12:100391776-100391798 TTTCACAGATGAAGAAACTGAGG - Intronic
1101060284 12:100963972-100963994 TTTTACAAATGAAGAAACTGAGG + Intronic
1101325491 12:103711989-103712011 ATTTACAAATGAAGAATCTGAGG - Intronic
1101512078 12:105402453-105402475 TTTCACCAATGAAGAAACTGAGG - Intergenic
1101735159 12:107457958-107457980 TTTTACAAAGGAAGAAACTGAGG - Intronic
1101742924 12:107515083-107515105 TTTCACAGAAGAGGAAACTGAGG + Intronic
1101919615 12:108921811-108921833 TTTTACAGCTGAAGAAACTGAGG - Intronic
1101965173 12:109277454-109277476 TTTCACAGATGAAGAAACTGAGG - Intergenic
1102168820 12:110826692-110826714 TTTTACAAAAGAGGAAACTGAGG - Intergenic
1102262820 12:111455169-111455191 TTTCATAACAGAACTCTCTGAGG - Intronic
1102327725 12:112002656-112002678 TTTCACAAAAGAGGAAATTGTGG - Intronic
1102556781 12:113731928-113731950 TTTCACAGAAGAAGAAACAGAGG + Intergenic
1102557546 12:113737585-113737607 TTTCAGAAATGAAGAATTTGAGG + Intergenic
1102655385 12:114478715-114478737 TTTTACAAATGAAGAAACTGAGG - Intergenic
1102677161 12:114666612-114666634 TTTTACAAGAGAGGAAACTGAGG - Intergenic
1103002972 12:117400114-117400136 TTTTACAAATGAGGAATCTGAGG - Intronic
1103011138 12:117459338-117459360 TTTCACAGAAGCAGGATCTGAGG - Exonic
1103043628 12:117717029-117717051 TTTCAGAACTGTAGAAGCTGAGG + Intronic
1103105850 12:118224116-118224138 TTTCCCAACTGAAGAAACTGAGG + Intronic
1103118166 12:118355868-118355890 TTTTACAGAAGAAGAAACTGAGG + Intronic
1103196100 12:119044965-119044987 TTTCACAGTTGAAGAAACTGAGG - Intronic
1103270113 12:119666498-119666520 TTTCACAAAAGAAGAGACTAAGG + Intergenic
1103583259 12:121932304-121932326 TTTTACAGAAGAAGAAACTGAGG + Intronic
1103717526 12:122953927-122953949 TTACACAAAAGAGGAAACTGAGG + Intronic
1103742461 12:123100073-123100095 TTTCACAGAAGAAGAAACTGAGG + Intronic
1103843948 12:123888280-123888302 TTTCACAGCTGAGGAAACTGAGG + Intronic
1105533359 13:21240937-21240959 TTACACAACAGCAGCATTTGTGG - Intergenic
1106147711 13:27065130-27065152 TTTTACAAAGGAAGAATCTAAGG - Intergenic
1106174309 13:27316568-27316590 TTTGAAAAAAGAAGAACCTGTGG + Intergenic
1106567047 13:30895329-30895351 TTTCACAAATGAGGAAACTGAGG + Intergenic
1106653181 13:31714432-31714454 TTTCACAGATGAAGAATTTGAGG + Intergenic
1106902071 13:34363961-34363983 TTTCACAGATGAAGAAACTGAGG - Intergenic
1107543817 13:41418016-41418038 TTTAAAAACACAAGAAGCTGTGG + Intergenic
1107695962 13:43000159-43000181 TTTCACAGGAGAAGAAACTGAGG - Intergenic
1108115740 13:47125734-47125756 TTTCACTAAAGAGAAATCTGGGG + Intergenic
1108225830 13:48287749-48287771 TTTTACAACTGAAGTAACTGAGG - Intergenic
1108526163 13:51287782-51287804 TGTCAGAACAGAGGAAACTGAGG + Intergenic
1109162629 13:58994289-58994311 TTTAACAAAAGATGCATCTGAGG - Intergenic
1109179743 13:59199598-59199620 TTTCAAAACACATGAATTTGGGG - Intergenic
1109543598 13:63812700-63812722 TTTTACAACAGAGGAATGTGAGG - Intergenic
1109730453 13:66406296-66406318 TTTCATCGCTGAAGAATCTGGGG - Intronic
1109821845 13:67667582-67667604 TCTCACAAAAGAAGCATATGTGG + Intergenic
1110432581 13:75442229-75442251 TTTCACAGATGAAGAAACTGAGG - Intronic
1110610458 13:77481687-77481709 TTTCACAGATGAAGAAACTGGGG - Intergenic
1111387877 13:87552119-87552141 TTTAACAACAGCAGTTTCTGTGG + Intergenic
1112171059 13:96972030-96972052 TTTCACAAAAGAAAATTCTAAGG - Intergenic
1112383953 13:98920432-98920454 TTTAACAAATGAAGAAACTGAGG + Intronic
1113156716 13:107331457-107331479 TTTCACAACTGGAGAAACAGAGG + Intronic
1113322996 13:109255111-109255133 TTTTACAAATGAGGAATCTGAGG - Intergenic
1113424321 13:110195438-110195460 TTTTACAAATGAAGAAACTGAGG + Intronic
1114058493 14:18997892-18997914 TTACACCACAGAAGTAACTGTGG + Intronic
1114104053 14:19403862-19403884 TTACACCACAGAAGTAACTGTGG - Intronic
1114414756 14:22534447-22534469 TTTTACAAAAGAAGAAACTGAGG + Intergenic
1114807128 14:25850579-25850601 TTTCACAAGTGAGGAATGTGAGG - Intergenic
1116054817 14:39850356-39850378 TTTCAAAAAAGAAAAATCAGTGG + Intergenic
1116123188 14:40747688-40747710 TTACAGAACAGAAGAATGTTTGG - Intergenic
1116604823 14:46977785-46977807 TTTCACAACAGCAGAAATTGGGG + Intronic
1118051056 14:62028398-62028420 TTTTACAAAAGAGGAAGCTGAGG + Intronic
1118176444 14:63445066-63445088 ATTTATAACAGAAGAAACTGAGG + Intronic
1118491203 14:66262683-66262705 TTTTACAAATGAAGAAACTGAGG + Intergenic
1118595005 14:67428496-67428518 TTTCACAAAGGAGGAATTTGAGG + Intergenic
1118752745 14:68818394-68818416 TTTCACATCTGAAAAATGTGGGG + Intergenic
1118838438 14:69493403-69493425 TTTCACTAGAGAGGAAACTGAGG - Intronic
1118847935 14:69562130-69562152 ATTCACAACAAAAGGATATGAGG - Intergenic
1118989529 14:70785167-70785189 TTTTATAACAGAGGAAGCTGAGG - Intronic
1119403656 14:74381720-74381742 TTTCTCAACCCAGGAATCTGGGG - Intergenic
1119425642 14:74533264-74533286 TTTTACAGGAGAAGAAACTGAGG + Intronic
1119485802 14:74985589-74985611 TTTTACAGCAGAAGAAGCTGAGG - Intergenic
1119665375 14:76481571-76481593 TTTCACACAAGAAGCATCTGAGG - Intronic
1119880194 14:78093684-78093706 TCTTACAAATGAAGAATCTGGGG - Intergenic
1120197339 14:81499406-81499428 ATTAACATCAGAAGAATTTGTGG - Intronic
1120224508 14:81775811-81775833 TTTCACAGAAGTAGAAACTGAGG + Intergenic
1120347839 14:83312924-83312946 TTTCACATCAGTGTAATCTGAGG + Intergenic
1120421814 14:84296491-84296513 TTTCACCACAGATGAAGCAGTGG + Intergenic
1120513587 14:85444616-85444638 TTTTACAAAAGAGGAAGCTGAGG + Intergenic
1120809400 14:88787934-88787956 TTCCCAAACAGAATAATCTGAGG + Intronic
1121080619 14:91104872-91104894 TTTCACCAAAGAAAAAACTGAGG - Intronic
1121206205 14:92170264-92170286 GTTAACAATAGAAGAATCTAGGG - Exonic
1121246231 14:92462775-92462797 TTTCACAGGTGAAGAAACTGAGG + Intronic
1121494629 14:94383674-94383696 TTTTACAAAAGAAGAAAATGAGG + Intronic
1121578762 14:95010616-95010638 TTTCACTGCTGAGGAATCTGAGG - Intergenic
1121634975 14:95447816-95447838 TTTGACAAAAGAGGAAACTGAGG - Intronic
1121642964 14:95498702-95498724 TTTTACAAATGAGGAATCTGGGG - Intergenic
1121919185 14:97864935-97864957 TTTCAGATAAGAAGAAACTGCGG + Intergenic
1122106384 14:99460047-99460069 TGTCACAAGAGAAGAACATGTGG + Intronic
1122262692 14:100532129-100532151 TTTCACAGAAGGAGAAACTGAGG - Intergenic
1122437087 14:101707629-101707651 TTACACAGCCGAAGAATCTGAGG + Intergenic
1124029658 15:25998785-25998807 TTTTACAGAAGAAGAAACTGAGG - Intergenic
1124080753 15:26492786-26492808 TTCTCCAACAGAAGAAACTGGGG + Intergenic
1124103194 15:26714163-26714185 TTTTACAAGGGAAGAAACTGAGG - Intronic
1124684322 15:31768051-31768073 TTTCACAGCAGGAGAAGCAGGGG - Intronic
1124875939 15:33593292-33593314 TTTTACAAGAGAAGAGTCTCTGG + Intronic
1125340718 15:38672776-38672798 TTTCACAGAAGAGGAAACTGGGG + Intergenic
1125810515 15:42536603-42536625 TTTCTCAATAGCAGAAGCTGTGG - Intronic
1126268098 15:46778739-46778761 ATTCACAACGGTAGAAACTGAGG + Intergenic
1127242298 15:57129783-57129805 TTTCACAGATGAAGAAACTGAGG + Intronic
1127316018 15:57794241-57794263 TTTTACAAATGAAGAAACTGAGG - Intergenic
1127435472 15:58953178-58953200 TTTCTCCAAAGAAGAATTTGAGG - Intronic
1127915047 15:63448432-63448454 TTTTAAAACGGAAGAATATGTGG - Intergenic
1128079361 15:64847033-64847055 TTTCACAGATGAAGAAACTGAGG + Intronic
1128440607 15:67704994-67705016 TTTTACAAATGAAGAAACTGAGG - Intronic
1128572817 15:68747666-68747688 TCTCACAGCTGAAGTATCTGTGG - Intergenic
1128600306 15:68990245-68990267 TTTCACAGATGAAGAAACTGAGG - Intronic
1128732078 15:70028070-70028092 TTTAACAAAGGAAGAAACTGAGG + Intergenic
1129029655 15:72609078-72609100 TTTCATTACAGCAGAATCTAAGG + Intergenic
1129153987 15:73706308-73706330 TTTCACAGACGAAGAAACTGAGG + Intronic
1129159084 15:73737185-73737207 TTTCACAGAGGAAGAAACTGAGG - Exonic
1129889187 15:79059544-79059566 TTTCACAAATGAAGAAACTGAGG + Intronic
1129920242 15:79313454-79313476 TTTTACAGAAGAAGAAACTGAGG - Intronic
1130094161 15:80843908-80843930 TTTTACAGAAGAAGAAACTGAGG + Intronic
1130413316 15:83665539-83665561 TTTCATAACAGAAAAAACTTAGG + Intronic
1130436055 15:83901147-83901169 TATGACCACAGAAGAAACTGTGG + Intronic
1131062451 15:89412189-89412211 TTTCACAACGGAGGAAACTGAGG - Intergenic
1131081748 15:89542433-89542455 TTTCTCAACACCAGAATTTGTGG + Intergenic
1132115417 15:99132107-99132129 TTTTGCAACAGAAGAGTCAGTGG + Exonic
1133859229 16:9578398-9578420 TTTCACAAATGAGGAAACTGAGG - Intergenic
1134068652 16:11246780-11246802 TTTCACAAGTGAGGAAACTGAGG + Intergenic
1134206909 16:12245935-12245957 TTTCACAGAAGATGATTCTGGGG - Intronic
1134393324 16:13839806-13839828 TTTCACAAGAGAGGAAAATGAGG + Intergenic
1135157619 16:20066858-20066880 TCTCACAGCTGAAGAAACTGAGG + Intronic
1135263430 16:21000661-21000683 TTTCACAGATGAAGAAACTGAGG - Intronic
1135686701 16:24503584-24503606 TTTTACAGTAGAAGAAACTGAGG + Intergenic
1136078753 16:27837730-27837752 TTACAGAAAAGAAAAATCTGTGG - Intronic
1136104938 16:28023679-28023701 TTTCACAGGTGAAGAAACTGAGG + Intronic
1136387802 16:29940915-29940937 CTTGACCACAGAGGAATCTGGGG + Intronic
1137408563 16:48208817-48208839 TTTCACAAATGGAGAAACTGAGG - Intronic
1137591743 16:49697980-49698002 TTTCCCCACAGCAGCATCTGGGG + Intronic
1137739740 16:50757129-50757151 TTTTACAACAAAAGAAACTGAGG - Intronic
1138264100 16:55647184-55647206 TTTCACAGATGAAGAAACTGAGG + Intergenic
1140035625 16:71369278-71369300 TTTCACAGGAGAAGAAACTGAGG + Intronic
1141071768 16:80963071-80963093 TTTCACAGATGAAGAAACTGAGG + Intergenic
1141079462 16:81037328-81037350 TTTCACAGCAGAAAACTCTGAGG + Intronic
1141317550 16:82976593-82976615 TTTTACAACTGTAGAAACTGAGG + Intronic
1141378000 16:83549298-83549320 TTGCACAAAAGAAGAATGAGAGG - Intronic
1141405112 16:83785720-83785742 CTGCACAACAGAAGCACCTGGGG + Intronic
1141523563 16:84597342-84597364 TTTCACAGATGAAGAAACTGAGG + Intronic
1141794362 16:86260160-86260182 TTTTACAGAAGAAGAACCTGAGG + Intergenic
1141803558 16:86327350-86327372 TTTCACAGAAGAAGAAACTGAGG - Intergenic
1141813887 16:86396166-86396188 TTTTACAAAAGAGGAAACTGAGG - Intergenic
1141877674 16:86837246-86837268 TTTCAAAACAGACAAAGCTGGGG + Intergenic
1142624772 17:1184925-1184947 TTTCACAGAAGAAGAAATTGAGG + Intronic
1143673136 17:8410722-8410744 TTTCACAAGAGAAGCAGGTGAGG - Intergenic
1143713111 17:8747085-8747107 TATCACAAAAGAAGAATGAGAGG + Intergenic
1144736642 17:17559330-17559352 TTTCACAGAAGAGGAAACTGAGG + Intronic
1144759605 17:17699960-17699982 TTTTACACAAGAGGAATCTGAGG - Intronic
1144845798 17:18218283-18218305 TTTTACAAAGGAAGAAACTGAGG - Intergenic
1144951775 17:18998303-18998325 TTTTACAAGTGAAGAAACTGAGG + Intronic
1145194427 17:20877028-20877050 TTTCCCAAAAGAAGAGTTTGGGG - Intronic
1145297607 17:21604030-21604052 TTTCCCAAAAGAAGAGTTTGGGG + Intergenic
1145352646 17:22099374-22099396 TTTCCCAAAAGAAGAGTTTGGGG - Intergenic
1146394487 17:32452616-32452638 TTTCAAAACAGAGGAAGTTGGGG + Intronic
1146496403 17:33326456-33326478 TTTCATAAGTGAAGAATTTGAGG - Intronic
1146644206 17:34566056-34566078 TTTCACAGAAGAGGAAACTGAGG - Intergenic
1146720583 17:35120776-35120798 TTTCACCAATGAAGAAACTGAGG + Intronic
1146726876 17:35163635-35163657 TTTTACAAATGAAGAAGCTGAGG + Intronic
1146931588 17:36782046-36782068 TTTTTCATCTGAAGAATCTGAGG + Intergenic
1147764017 17:42820967-42820989 ATTTACACCAAAAGAATCTGTGG + Intronic
1147872442 17:43597128-43597150 TTTTACAAAAGAAGAAACTCAGG - Intergenic
1148463896 17:47853079-47853101 TTTCACCAAGGAAGAAACTGAGG - Intronic
1148632166 17:49119580-49119602 TTTTACAACTGAAGATGCTGAGG + Intergenic
1148657502 17:49298671-49298693 GTTCACCACAGAAGGAACTGGGG + Exonic
1149010022 17:51846534-51846556 TTTCACAAGTGAAGACACTGAGG + Intronic
1149150585 17:53558987-53559009 TTTTATAAAAGAAGTATCTGTGG + Intergenic
1149269384 17:54959935-54959957 TTTGAAACCAGAAGAAACTGAGG + Intronic
1149358817 17:55871423-55871445 TTTCAGCACAGAAGAGTCTCTGG + Intergenic
1149472783 17:56932595-56932617 TTTCACAGAAGAGGAAACTGAGG - Intergenic
1149781936 17:59404660-59404682 TTTCACAGAAGAAGAAACTGAGG + Intergenic
1150329424 17:64282943-64282965 TTTCACAGATGAAGAAGCTGTGG - Intergenic
1150843206 17:68628669-68628691 TTTTACAATTGAAGAATCTAAGG - Intergenic
1151327565 17:73388517-73388539 ATTCAGAACAGATGACTCTGTGG + Intronic
1151713613 17:75820291-75820313 TTTCACAGCAGAGGAAACTAAGG - Intronic
1152103279 17:78315042-78315064 TTTTACAGAAGAAGAAACTGAGG - Intergenic
1152291958 17:79444957-79444979 GTCCAGAACAGAAAAATCTGTGG - Intronic
1152452878 17:80394218-80394240 TGTCAGATCAGAAGAATCTTTGG - Exonic
1153258624 18:3198855-3198877 TTTCACATCAGAATCAGCTGAGG + Intronic
1153333246 18:3896149-3896171 TTTCACAGATGAAGAAACTGAGG + Intronic
1153852021 18:9103726-9103748 TTTTACAACTGAAGAAACTGAGG - Intronic
1153868584 18:9296219-9296241 TTTTACAGCTGAAGAAACTGAGG + Intergenic
1155586165 18:27368089-27368111 TTTTACAAAAGATGAAACTGAGG + Intergenic
1155889686 18:31251491-31251513 TTTGACAGCAGAAGACACTGAGG + Intergenic
1156747037 18:40404778-40404800 TTATCCAACAGAAGATTCTGAGG - Intergenic
1156930874 18:42641682-42641704 TTTTACAAATGAAGAAACTGAGG - Intergenic
1156942392 18:42784431-42784453 TTCTACAACAGAAGAAATTGAGG - Intronic
1157118354 18:44883737-44883759 TTTTACAAAAGAAGACACTGAGG + Intronic
1157575871 18:48742687-48742709 TTTCACAAATGGAGAAACTGAGG + Intronic
1158094014 18:53749555-53749577 TTTTACAATAGAAGAATCTGAGG + Intergenic
1158401456 18:57125235-57125257 TTTCACAAATGAAGAAACTATGG - Intergenic
1159934036 18:74347132-74347154 TTTTACAACTGAGGAAACTGGGG - Intronic
1160111741 18:76038629-76038651 TTTCACAGATGAAGAAACTGAGG - Intergenic
1160266358 18:77343086-77343108 CTCCACATCAGCAGAATCTGGGG - Intergenic
1162330686 19:10027474-10027496 TTTCACAGATGAAGAAACTGAGG - Intergenic
1162346425 19:10120657-10120679 TTTTACAGCTGAAGAAACTGAGG + Intergenic
1162530218 19:11231636-11231658 TTTTACAAATGAAGAAACTGAGG + Intronic
1162733530 19:12733219-12733241 TTTAACAAATGAAGAAACTGAGG + Intronic
1162795692 19:13086455-13086477 TTTCACAACTGAGGAAACTGAGG - Intronic
1163268589 19:16235773-16235795 GTTCACAGAAGAAGCATCTGGGG - Intronic
1163430512 19:17264403-17264425 TTTCACAGCAGAGGAAATTGAGG - Intronic
1163559263 19:18009325-18009347 TTTCACAGAAGAGGCATCTGAGG - Intronic
1165723941 19:38099732-38099754 TTTCACAAAAGAGCAAGCTGAGG + Intronic
1166724394 19:45017327-45017349 TTTTAAAAAAGAAAAATCTGGGG + Intronic
925359194 2:3265801-3265823 TTTCACAAATGAGGAAACTGAGG + Intronic
925703748 2:6664616-6664638 TTTCATAGAAGAGGAATCTGAGG - Intergenic
925865667 2:8223941-8223963 TCTCACAAGTGAAGAAACTGAGG - Intergenic
926072549 2:9910141-9910163 TTTTACAAGTGAAGAAACTGAGG + Intronic
926108388 2:10166599-10166621 TTTCACAGCTGAAGAAACTGAGG + Intronic
926626901 2:15097791-15097813 TTTCCCAAAAGAGTAATCTGGGG - Intergenic
926717885 2:15939471-15939493 TTTCACAATTGAGGAAACTGAGG + Intergenic
926863060 2:17328993-17329015 TTTTATAACTGAAGAATCTCTGG + Intergenic
926988165 2:18646787-18646809 TTTTACAAATGAGGAATCTGTGG - Intergenic
927157096 2:20226656-20226678 GCTCACAACAGAGGAAACTGGGG + Intergenic
927265670 2:21146976-21146998 TTTTACACAAGAAGAAACTGAGG - Intergenic
927881211 2:26691594-26691616 TTTGACAAATGAAGAAACTGAGG + Intergenic
929234630 2:39593058-39593080 TTTTACAGAAGAAGAAACTGAGG - Intergenic
929364533 2:41137086-41137108 GTTCCCCACAGAAGAATCAGTGG + Intergenic
929419755 2:41778659-41778681 TTTTACAGGTGAAGAATCTGAGG + Intergenic
929700132 2:44155298-44155320 TTTCATAAATGAAGAAACTGAGG - Intergenic
930023632 2:47016406-47016428 TTTCACAGCAGAAGGCGCTGAGG - Intronic
930316992 2:49809901-49809923 TTTTACAAAAGAGGAAACTGGGG + Intergenic
930343998 2:50155154-50155176 TTCCATAATAAAAGAATCTGTGG - Intronic
931058341 2:58498309-58498331 TTTAACCTCAGAATAATCTGTGG - Intergenic
931066203 2:58590235-58590257 TTTCCCAAATGAAGAAACTGAGG - Intergenic
931636806 2:64348315-64348337 TTTTACACAAGAGGAATCTGGGG + Intergenic
931790162 2:65657897-65657919 TTTCACAGGGGAAGAAACTGAGG + Intergenic
931878425 2:66540103-66540125 TTTCACAGATGAAGAAGCTGAGG - Intronic
932043348 2:68322299-68322321 TTTTACAAATGAAGAAACTGGGG - Intergenic
933723955 2:85415758-85415780 TTTCACAGATGAGGAATCTGTGG - Intronic
933921210 2:87048663-87048685 TTTTACAAATGAAGAAACTGAGG + Intergenic
934001756 2:87720922-87720944 TTTTACAAATGAAGAAACTGAGG - Intergenic
934024440 2:87988873-87988895 TTCCCCAACAGAAGAACCTCAGG + Intergenic
934046689 2:88178563-88178585 TTTAGGAACACAAGAATCTGAGG + Intronic
934084302 2:88497251-88497273 TTTTACCAAAGAGGAATCTGGGG + Intergenic
934799815 2:97142947-97142969 TATCACAAAAGCAGAATCTCAGG - Intronic
936365129 2:111846902-111846924 TTCCCCAACAGAAGAACCTCAGG + Intronic
936732617 2:115402195-115402217 TTTCCCAACTGTAGAAACTGTGG - Intronic
937267945 2:120629259-120629281 TTCCACAACAGAAGAATTCTGGG + Intergenic
937885051 2:126893940-126893962 TTCCACTGCAGAAGAGTCTGTGG + Intergenic
938159790 2:128974834-128974856 TTTTATAACAGAGGAAACTGAGG + Intergenic
938476967 2:131625164-131625186 TTACACCACAGAAGTAACTGTGG + Intergenic
938653518 2:133408033-133408055 TTTCACAACTGAAAAATCAGAGG + Intronic
938669325 2:133572042-133572064 TTTCACAACCAAGGAAACTGAGG + Intergenic
938671768 2:133593775-133593797 TTTCACAGAAGAAGAAACAGAGG - Intergenic
938677925 2:133657714-133657736 CCTCACAATAAAAGAATCTGAGG - Intergenic
939129554 2:138217921-138217943 TTTCACAAATGAAGAAACTGAGG + Intergenic
939261075 2:139810089-139810111 TTTTACAAGTGAAGAAACTGTGG - Intergenic
939679425 2:145111990-145112012 TTTCATAAAAGAAGAATTTGGGG + Intergenic
939737348 2:145864944-145864966 ATTGACAATAGGAGAATCTGAGG - Intergenic
939767008 2:146263181-146263203 TTTCACAGACGAAGAAACTGAGG + Intergenic
939780063 2:146435104-146435126 TTTTACATCTGAAGAAACTGAGG + Intergenic
939834309 2:147109503-147109525 TTTCAGAAGAGAAAAAGCTGAGG + Intergenic
940103120 2:150064897-150064919 TTTTACAGAAGAAGAAACTGAGG - Intergenic
940533680 2:154910690-154910712 TTGCAAAACAAAAGAATGTGAGG - Intergenic
940810661 2:158239010-158239032 TTTCATAAATGAAGAAACTGAGG - Intronic
941307526 2:163889992-163890014 TTTCACAGATGAAGAAACTGAGG - Intergenic
941383649 2:164826558-164826580 TTCCACAATAGAAGAAACTGTGG + Intronic
941435677 2:165468277-165468299 TTTCACAACAGAGGACTTGGCGG + Intergenic
941697665 2:168570773-168570795 TTTCACAGAAGAAAAATCTGGGG - Intronic
941721560 2:168818044-168818066 TATCCCAACAGAAGAATTTGAGG + Intronic
942641383 2:178064479-178064501 TTTTACAAAAGGAGAAACTGAGG - Intronic
943433521 2:187833977-187833999 TTTCACAGAAGAAGCTTCTGAGG - Intergenic
943536911 2:189163814-189163836 TTTTGCAACAGAAGTAACTGAGG + Intronic
944039926 2:195341623-195341645 TTTCACAAATGAGGAAACTGAGG + Intergenic
944409779 2:199428591-199428613 TTTCACAGAAGAGGAAACTGAGG - Intronic
944657901 2:201894662-201894684 TTTCACAAAAGAGGAGACTGAGG + Exonic
944880983 2:204012760-204012782 TCTCACAACAGTAGAACCTAGGG - Intergenic
944884934 2:204052986-204053008 TTTCACACATGAAGATTCTGTGG + Intergenic
944886835 2:204071820-204071842 TTTTACAGCTGAAGAAACTGAGG + Intergenic
944984486 2:205159813-205159835 TTTCACAAATGAGGAAACTGAGG - Intronic
944997906 2:205315272-205315294 TTTCACAAGAGAGGAAACTGAGG - Intronic
945197728 2:207252933-207252955 TCTCACAAAATCAGAATCTGTGG + Intergenic
945300459 2:208211531-208211553 TTTCATAAAAAAAGAAACTGAGG - Intergenic
945640999 2:212429646-212429668 TTTGACAAAATAAGAAACTGAGG + Intronic
945766329 2:213983583-213983605 TTCCATGAAAGAAGAATCTGGGG + Intronic
946124955 2:217554445-217554467 TGTCACAGGAGAAGAATCCGAGG - Intronic
946277384 2:218641878-218641900 TTTAACAGATGAAGAATCTGAGG + Intronic
946283274 2:218682243-218682265 TTTTACAACTGATGAATTTGGGG - Intronic
946301405 2:218826729-218826751 TTTCACAAAGGAGGAAACTGAGG + Intronic
946805562 2:223468238-223468260 GTTCAAACCAGAAGAAACTGAGG - Intergenic
947358226 2:229318814-229318836 TCTCACAGCAGAAGAAACTAAGG - Intergenic
948562765 2:238865151-238865173 TTTCACAGCAGGGGAAACTGAGG + Intronic
949077716 2:242071707-242071729 TTTTACAAAAGAGGAAACTGAGG - Intergenic
1168768461 20:398116-398138 TTTCACAGATGAAGAATCTGAGG - Intergenic
1168813460 20:721164-721186 TTTTACACCTGAGGAATCTGAGG + Intergenic
1168902465 20:1376642-1376664 TTTCACAGATGAAGAAACTGAGG + Intronic
1168940447 20:1706959-1706981 TTTCACTACAGGAGGAGCTGAGG + Intergenic
1169748458 20:8966827-8966849 TTTCACAAATGAACAAACTGTGG + Intronic
1169749710 20:8979531-8979553 TTTCACAAAAGAAGAATAAAAGG + Intergenic
1169837640 20:9898348-9898370 TTTTACAAAAGAAGAAACCGAGG + Intergenic
1169953878 20:11080011-11080033 TTTCACAGATGAAGAAACTGAGG - Intergenic
1169972778 20:11287686-11287708 TTTCACTAGAGATGAATCAGAGG + Intergenic
1169995349 20:11550080-11550102 TTTCACAAATGAGGAAACTGGGG + Intergenic
1170290929 20:14767580-14767602 TTTAACCAAAGAAGAAACTGAGG - Intronic
1170351895 20:15450822-15450844 TTGCACATCAGAAGCACCTGAGG - Intronic
1170783379 20:19447154-19447176 TTTCACAGATAAAGAATCTGAGG - Intronic
1170813271 20:19691852-19691874 TTTCACAGATGAAGAAACTGAGG + Intronic
1170914808 20:20612590-20612612 TATAACAACAGATGACTCTGGGG - Intronic
1171326141 20:24294923-24294945 ATTCACCACAGCAGAATCTCAGG + Intergenic
1171452240 20:25244321-25244343 GTTCACAAAAGAGGCATCTGAGG - Intergenic
1171489941 20:25509728-25509750 TGTGAAAACAGAAGATTCTGTGG - Intronic
1172029238 20:31969678-31969700 TTTCACAGAAGAGGAAACTGAGG - Intronic
1172114296 20:32564541-32564563 TTTTGCAGCAGAAGAAACTGAGG + Intronic
1172195987 20:33091953-33091975 CTTAACAAAAGAAGAATGTGGGG + Intronic
1172372241 20:34403330-34403352 CTTCAGAACAGAAGGATCAGAGG + Intronic
1172595836 20:36150630-36150652 TTTCACAGCTGAAGTAACTGAGG - Intronic
1172639063 20:36430168-36430190 TTTTACAACAGGGGAAACTGAGG + Intronic
1173200416 20:40950691-40950713 TTTCACAGGAGAAGAAACTGAGG - Intergenic
1173353534 20:42266148-42266170 TTTCACAAATGAAGAAGGTGAGG + Intronic
1173639910 20:44594327-44594349 TTTCACAGATGAAGAACCTGAGG + Intronic
1173639933 20:44594536-44594558 TTTTACAAAAGAAGAAACTGAGG + Intronic
1173825756 20:46046796-46046818 TTTCACAGCTGAGGAAACTGAGG - Intronic
1173881430 20:46415678-46415700 TTTTACAGAAGAAGAAACTGAGG + Intronic
1173954140 20:47017781-47017803 TTTCACAGAAGAGGAAACTGAGG + Intronic
1174015644 20:47485991-47486013 TTTCACAAACGTAGAAACTGAGG + Intergenic
1174058762 20:47817561-47817583 TTTTACAGCAGAGGAAACTGAGG - Intergenic
1174209231 20:48864179-48864201 TTTCACAAAGAAAGAAACTGAGG + Intergenic
1174404222 20:50293270-50293292 TTTCACAGCTGGAGAAACTGAGG + Intergenic
1174417156 20:50375015-50375037 TTTCACAGCAGCAGAAACTGAGG - Intergenic
1174428539 20:50450623-50450645 TTTTACAGAAGAAGAAACTGAGG + Intergenic
1174506126 20:51018720-51018742 TTTTACAAATGAAGAAACTGAGG + Intronic
1174547501 20:51336690-51336712 TTTCACATATGAAGAAACTGAGG - Intergenic
1174550565 20:51358523-51358545 TTTCACAGATGAAGAAACTGAGG - Intergenic
1174584538 20:51597823-51597845 TTTCAGCAGAGAAGAAACTGAGG + Exonic
1174849771 20:53981602-53981624 TTTTATAACTGAAGAAACTGAGG + Intronic
1174859699 20:54079254-54079276 TTTTGCAGCTGAAGAATCTGAGG - Intergenic
1174959616 20:55140450-55140472 TTTTACAGAAGAAGAAACTGAGG - Intergenic
1175130576 20:56786438-56786460 TTTTACAAATGAAGAAACTGAGG - Intergenic
1175169996 20:57073684-57073706 TTTCACAGATGAAGAAACTGAGG + Intergenic
1175289298 20:57863325-57863347 TTTTTCAGCAGAAGAAACTGAGG + Intergenic
1175683323 20:61007220-61007242 TGTTACAACGGAAGAAACTGAGG - Intergenic
1177093748 21:16804574-16804596 TGTCACCAGAGAAGAAACTGAGG - Intergenic
1178796313 21:35747572-35747594 TCCCAGAACACAAGAATCTGAGG + Intronic
1178881486 21:36453679-36453701 TTTTATAACAGAAGTATCTGAGG + Intergenic
1179064319 21:38010134-38010156 TTTTACAAATGAAGAAACTGAGG - Intronic
1179141450 21:38729178-38729200 CTTCACAGCTGAAGAAACTGAGG + Intergenic
1180476980 22:15720511-15720533 TTACACCACAGAAGTAACTGTGG + Intronic
1180674856 22:17580234-17580256 TTTCACAAAGGAAGAAACTTGGG - Intronic
1181117581 22:20642657-20642679 TGTCACAAGAGAAGTTTCTGGGG + Intergenic
1181161740 22:20963806-20963828 TTTCACAAACGGAGAAACTGAGG - Intergenic
1181673691 22:24438243-24438265 TTTTACAAATGAAGAAACTGAGG + Intronic
1182086718 22:27565967-27565989 TTTTACAACTGAGGAAACTGAGG - Intergenic
1182115425 22:27753612-27753634 TTTCACAGAAGGAGAAACTGAGG + Intronic
1182302825 22:29347409-29347431 TTTTACAAATGAAGAAACTGAGG + Intronic
1182317136 22:29455439-29455461 TTGCTCAACAGAAGGATCAGTGG - Intergenic
1182327991 22:29528896-29528918 TTTCACAAAGGAATAAACTGAGG + Intronic
1182744764 22:32597063-32597085 TTTGACAAATGAAGAAACTGAGG - Intronic
1182900075 22:33890464-33890486 TTTCACAAATGAAAAAACTGAGG + Intronic
1183014119 22:34971962-34971984 GTTCACAAATGAGGAATCTGAGG - Intergenic
1183191236 22:36323238-36323260 TTTCACAGAAGAGGAAGCTGAGG + Intronic
1183405006 22:37626086-37626108 CTTCACAACTGAGGAAACTGAGG + Intronic
1184414326 22:44343485-44343507 TCTCACAAACGAAGAAACTGAGG + Intergenic
1184980224 22:48090396-48090418 TTTTACAAAAGAGGAAACTGAGG - Intergenic
949441116 3:4081644-4081666 TTTTATAACTGAAGAAGCTGAGG - Intronic
949506114 3:4729233-4729255 TTTTACAGCAGAAGAAACTGAGG - Intronic
949597887 3:5566837-5566859 TTTCAAAAGAGAAGAATCAGTGG - Intergenic
949699791 3:6743390-6743412 TTTCACAGATGAAGAAACTGAGG + Intergenic
949762036 3:7481557-7481579 TTTCTCAGCAGAGGAAACTGAGG - Intronic
949789315 3:7775599-7775621 TTTCAAAACAGAAGGAACTGAGG - Intergenic
949934135 3:9103469-9103491 TTTCACAAATGAGGAAACTGAGG + Intronic
949938943 3:9139002-9139024 ATTCACAAGAGGAGAAACTGAGG + Intronic
949982711 3:9512268-9512290 TTTCACAGGGGAAGAAACTGAGG - Intronic
950121471 3:10484897-10484919 TTTCACAGCTGAGGAAACTGAGG - Intronic
950743691 3:15069764-15069786 TTTCACACTGGAAGAAACTGAGG - Intergenic
951363596 3:21753183-21753205 TGTCACAAATGAAGAACCTGAGG + Intronic
951588756 3:24241256-24241278 TTTCACGGCAGAATCATCTGAGG + Intronic
951605744 3:24433131-24433153 TTTTACAGCTGAAGAAACTGTGG - Intronic
952556908 3:34542079-34542101 TTTCACAAATGGAGAAACTGAGG + Intergenic
952749251 3:36812056-36812078 TTTCACAAAGAAAGAAACTGAGG - Intergenic
952916060 3:38243407-38243429 TTTCACAAGAGAAGAGGCTGAGG - Intronic
953207684 3:40846287-40846309 TTTCACAAATGAAGAAACTGAGG + Intergenic
953343261 3:42153572-42153594 TTTCACAAATGAAGAAACTCGGG + Intronic
953781618 3:45876457-45876479 TTTTACAAAAGAGAAATCTGAGG + Intronic
954704062 3:52469437-52469459 TTTCACAAATGAACAACCTGAGG - Intronic
954908390 3:54082598-54082620 TTTCACAGAGGAAGAAACTGAGG - Intergenic
955215273 3:56980030-56980052 ATTCACAAATGAGGAATCTGAGG - Intronic
955743534 3:62118102-62118124 TTTCCAGACTGAAGAATCTGAGG + Intronic
956113286 3:65892860-65892882 TTTGACAACTGAAGAAACTGAGG + Intronic
956202334 3:66719416-66719438 TTTCACACCAGAAAGAGCTGTGG - Intergenic
956307196 3:67838272-67838294 TTCCAAAACAGAAGAACCTGGGG - Intergenic
956412919 3:68997030-68997052 TTTCAGAGCTGAAGATTCTGGGG + Intronic
956446847 3:69334219-69334241 TTTTACAAATGAAGAAACTGGGG - Intronic
956519557 3:70088660-70088682 TTTCAAAAAAGAGGAAACTGAGG - Intergenic
956924535 3:73969703-73969725 TTTTACAAATGAAGAAACTGAGG + Intergenic
957157651 3:76566134-76566156 TTTCAGAACAGTAGATACTGTGG + Intronic
957230371 3:77505778-77505800 TTTGATAAATGAAGAATCTGAGG + Intronic
957254270 3:77816339-77816361 TTTTACAAATGAGGAATCTGAGG + Intergenic
958467898 3:94481121-94481143 ATTCACATCAGAAACATCTGGGG - Intergenic
958500547 3:94901875-94901897 TTTGATAAAAAAAGAATCTGGGG + Intergenic
958720435 3:97836923-97836945 TTCTACAACAGAAGAATGAGTGG - Intronic
959160631 3:102720312-102720334 TTTCACAGAAAAAGAAACTGAGG - Intergenic
959595367 3:108123340-108123362 TTTCACAGTTGAAGAAACTGAGG - Intergenic
959800768 3:110492960-110492982 TTTTACAGACGAAGAATCTGAGG + Intergenic
960041331 3:113152450-113152472 TTTTACAAATGAAGAAACTGAGG + Intergenic
960587631 3:119334816-119334838 TTTTACAAAGGAAGAAACTGAGG + Intronic
961047469 3:123719605-123719627 TTTCACACAAGAGGAAGCTGAGG + Intronic
961270493 3:125684029-125684051 TTTCACACAAGAGGAAGCTGAGG - Intergenic
961326887 3:126114244-126114266 TTTCAGAACAGATGGAGCTGTGG + Intronic
961557878 3:127709031-127709053 TTTCACAGATGAAGAAACTGAGG - Intronic
961611772 3:128145258-128145280 TTTGACAAATGAAGAAACTGAGG + Intronic
961823536 3:129587232-129587254 TTTCACCGAAGAGGAATCTGAGG + Intronic
962004810 3:131337844-131337866 TTTCACAGTTGAAGAAACTGAGG - Intronic
962392966 3:134988727-134988749 TTTCATAAAAAGAGAATCTGTGG - Intronic
962831066 3:139141034-139141056 TTCCATAACCAAAGAATCTGTGG - Intronic
962845881 3:139273472-139273494 TCTCACAACAGAGAACTCTGAGG + Intronic
963219744 3:142796115-142796137 TTTTACAGAGGAAGAATCTGAGG + Intronic
963535912 3:146528259-146528281 TTTTTCAAAAGAAGAAACTGAGG - Intronic
963838182 3:150078516-150078538 TTTCACAGCTGAGGAAACTGAGG + Intergenic
964730316 3:159857846-159857868 TTTTTCAAAAGAAGAAACTGAGG + Intronic
964733689 3:159894080-159894102 TTGCACAACAGAACCATGTGGGG + Intronic
964746657 3:160018969-160018991 TTTCACAGCTGAAGAGTCGGAGG - Intronic
964910597 3:161775910-161775932 TTTCAAAAAATAATAATCTGTGG - Intergenic
965048172 3:163606643-163606665 TTTTACAACTGAAGAAACTGAGG - Intergenic
965237583 3:166145572-166145594 TATCACAGCAGCAGAATTTGAGG + Intergenic
965428711 3:168560514-168560536 TTTCTCTGCAGAAAAATCTGTGG - Intergenic
965469286 3:169070798-169070820 TTTCACAGTTGAAGAAACTGAGG + Intergenic
965779060 3:172264423-172264445 TTTCTGAACTGAATAATCTGTGG + Intronic
966170790 3:177077969-177077991 TTTCACAGTTGAAGAAACTGGGG - Intronic
966387269 3:179412579-179412601 TTTAAAAACTGAAGAATCTGAGG + Intronic
966404115 3:179577829-179577851 TTTCACTACATAATATTCTGTGG + Intronic
966615977 3:181912793-181912815 TTTGACAAATGAAGAAACTGAGG - Intergenic
967051337 3:185787411-185787433 TTTTATAACTGAAGAATTTGAGG + Intronic
967288777 3:187899046-187899068 TTTTACAGAAGAGGAATCTGGGG - Intergenic
967385475 3:188906665-188906687 TTAGGCAACAGGAGAATCTGTGG + Intergenic
967390123 3:188947336-188947358 TTTTACAAAAGGAGAAACTGAGG - Intronic
967473890 3:189893273-189893295 TTTTACCAAAGAAGAAACTGAGG + Intronic
969150359 4:5164025-5164047 TTTCACAGTAGAGGAAACTGAGG + Intronic
969321594 4:6416282-6416304 TTTTACAACAGAGAAAACTGAGG + Intronic
969327536 4:6452518-6452540 TTTCACAGAAGAGGAAACTGAGG + Intronic
969371278 4:6733065-6733087 TTTCACAGCTGAGGAAACTGAGG + Intergenic
969620448 4:8276258-8276280 TTTCACAGATGAAGAAACTGAGG - Intronic
969861162 4:10036291-10036313 TTTCACAAATGAGGAAACTGAGG - Intronic
970075902 4:12219787-12219809 TTTTACAAAAGAGGAAACTGAGG - Intergenic
970440698 4:16078898-16078920 TTTGACAAAGGAAGAATTTGGGG - Intronic
970700526 4:18731776-18731798 TTACTCAAAAGAAAAATCTGGGG - Intergenic
970709104 4:18841642-18841664 TTTCACAAATGCAGAAACTGAGG + Intergenic
970772524 4:19631182-19631204 CTTGACAACAGCTGAATCTGAGG + Intergenic
971329630 4:25671865-25671887 TTTCACAGCAGAGGAAACTATGG + Intronic
971782299 4:31052482-31052504 TTTCACTACAGAATGATCTTTGG - Intronic
971981419 4:33756061-33756083 TTTTACAAAAGAAGATTCTATGG - Intergenic
972031703 4:34467953-34467975 TTTCACTAAAAAAGAATATGAGG + Intergenic
972139687 4:35942265-35942287 TTTCTCAACAGGAAAATCTGAGG + Intergenic
972190294 4:36583416-36583438 TTTGAGAACAAAAGAATATGAGG - Intergenic
972302515 4:37798348-37798370 TTTTATAGCAGAAGAAACTGAGG + Intergenic
972458056 4:39273283-39273305 TATCACAGCAAAAGGATCTGAGG + Intronic
972625249 4:40791445-40791467 TTTTACAAATGAGGAATCTGAGG + Intronic
972672055 4:41221940-41221962 TTTTATAACAGAGGAAACTGAGG + Intergenic
972977843 4:44659521-44659543 ATTCATAACGGAAAAATCTGTGG + Intronic
973987714 4:56371568-56371590 TTCCACAACAGAAGGATCGAAGG + Exonic
974699999 4:65430114-65430136 TCCCACAACTGAAGAATATGTGG - Intronic
975490733 4:74985498-74985520 TTTCACAAGTGAAGAAATTGAGG + Intronic
975502771 4:75105115-75105137 TTTCAAATCAGTAGCATCTGAGG + Intergenic
975647347 4:76558309-76558331 TTTCACAAATGAGGAAACTGGGG - Intronic
976100939 4:81562554-81562576 TTTTACAAATGAAGAAACTGAGG + Intronic
976416874 4:84786662-84786684 TTTCACAGAAGAGGAAACTGAGG - Intronic
976420519 4:84838298-84838320 TTTCACAAATGAAGCAACTGAGG + Intronic
976427793 4:84926299-84926321 TTTCACAACAGAAGATAAAGTGG + Intronic
976664745 4:87578253-87578275 TTTCACAAACGAGGAAACTGAGG - Intergenic
977013942 4:91669297-91669319 TTTTTCAAAAGAAGAAACTGAGG - Intergenic
977297868 4:95230854-95230876 TTTTACAAAGGAAGAAACTGAGG - Intronic
977359253 4:95982121-95982143 TCCCATAACAGAAGGATCTGGGG + Intergenic
977488823 4:97685764-97685786 TTTAATAACAGCAGAACCTGGGG + Intronic
977719328 4:100221673-100221695 TTTCAGACAAGAAAAATCTGAGG - Intergenic
977746836 4:100559047-100559069 GTTCACATCACAAGACTCTGCGG + Intronic
978220620 4:106269590-106269612 TTTCAAAACATCTGAATCTGAGG - Intronic
978254578 4:106679099-106679121 CTTCAGAAGAGAAGAATCAGTGG - Intergenic
978879470 4:113683982-113684004 TTTTACAAAAGAAGAAACTGAGG - Intronic
979771980 4:124537575-124537597 TTTAACAGAAGAAGAAGCTGAGG + Intergenic
979952018 4:126905166-126905188 TTTCACAAAAGAGGAAAGTGAGG - Intergenic
981470456 4:145128441-145128463 CTGCCCAACAGAAAAATCTGTGG - Exonic
981605880 4:146539618-146539640 TTTTACAACAGAATCATTTGAGG - Intergenic
981991193 4:150922879-150922901 GTTTACAGAAGAAGAATCTGAGG + Intronic
982316898 4:154041195-154041217 TTTCACAGGTGAAGAAACTGAGG + Intergenic
983118382 4:163849234-163849256 TTTCATAAATAAAGAATCTGAGG - Intronic
984326583 4:178262060-178262082 CTTCTCAAAAGAAGAAACTGTGG + Intergenic
984417474 4:179479600-179479622 TTTTACAACCGAAGAAACTGAGG + Intergenic
984928593 4:184826994-184827016 TTTCACAGAAGAGGAAGCTGGGG + Intergenic
985622973 5:965335-965357 TTACAGAACAGAAAAATATGGGG + Intergenic
986232320 5:5877644-5877666 TTTTTCCACAGAAGAACCTGGGG + Intergenic
987147247 5:15004284-15004306 TTTTACAGAAGAAGAAACTGAGG - Intergenic
987739124 5:21882899-21882921 TAACACAAATGAAGAATCTGGGG + Intronic
987821188 5:22968943-22968965 TTACAAAACAGAAGAGACTGGGG - Intergenic
988540194 5:32101448-32101470 TTTTACAAAAGGAGAAACTGAGG + Intronic
988714183 5:33808771-33808793 TTTCACAGATGAAGAAACTGAGG + Intronic
989238013 5:39171677-39171699 TTTCAAAACAAAAGAATGGGAGG - Intronic
989243731 5:39229850-39229872 CTTCACAAGAGAATAACCTGAGG + Intronic
989543219 5:42642057-42642079 TTTCAGATGAAAAGAATCTGAGG + Intronic
989627979 5:43450553-43450575 TTTTACAGCAGAGGAAACTGAGG + Intronic
990539727 5:56760342-56760364 TTTTACAAATGAAGAAACTGGGG + Intergenic
990763089 5:59152149-59152171 TTTTACAGAAGAAGAAACTGAGG - Intronic
990889543 5:60633109-60633131 TTTCACTTCTGAAGAATCTGAGG + Intronic
991490612 5:67179336-67179358 TTTAACATCAGAATAATCGGGGG - Intergenic
991553864 5:67873586-67873608 TTGCACAACAGAATCATCTGGGG + Intergenic
992097443 5:73376121-73376143 TTTCACAGATGAAGAAACTGAGG + Intergenic
992772989 5:80066413-80066435 TTTTACAATTGAAGAAACTGAGG + Intronic
992979557 5:82154485-82154507 TTTAACAAGTGAAGAAACTGAGG + Intronic
993084403 5:83346309-83346331 TTCCACAAATGAAGAAACTGAGG + Intronic
993985586 5:94593432-94593454 GTTGACCTCAGAAGAATCTGTGG - Intronic
994565028 5:101433516-101433538 TTTAAGAACAGTAGAATCTCAGG + Intergenic
994804686 5:104429174-104429196 TTTAAAAACAGAAGAATGTATGG + Intergenic
995229115 5:109738615-109738637 TTTGACAAATGAAGAAACTGAGG - Intronic
995344716 5:111098614-111098636 TTTCTTAACAGAAGCATCTCAGG + Intronic
995404750 5:111781964-111781986 TTTTACAAATGAAGAAACTGAGG - Intronic
995575358 5:113525500-113525522 TTTCACAGGTGAAGAAACTGAGG + Intronic
996265685 5:121536486-121536508 TTACAAGACAGAAGATTCTGGGG + Intergenic
997088149 5:130825521-130825543 TTTAACATCAGAAAAATTTGAGG - Intergenic
997744595 5:136288114-136288136 TTTTACAAAGGAAGAAACTGAGG + Intronic
998205251 5:140152937-140152959 TTACACAACAACAGAGTCTGCGG - Intergenic
998214368 5:140226227-140226249 TTTTATAGCAGAAGAAACTGAGG + Intronic
998694322 5:144621835-144621857 CTTCACAACAGAATAATCTCTGG + Intergenic
999062082 5:148646806-148646828 TTTCACAGATGAAGAAACTGAGG + Intronic
999374834 5:151079711-151079733 TTTTGCAACAGAAGAAACTGAGG - Intronic
999615109 5:153414791-153414813 TTTCACAAACGAGGAAACTGAGG - Intergenic
999673398 5:153976591-153976613 TTTTACAGAAGAAGAAACTGAGG + Intergenic
999772741 5:154787729-154787751 TTTCAGGACAGAGGAACCTGGGG + Intronic
999922304 5:156335045-156335067 TTTCATAAATGAAGAAACTGAGG - Intronic
1000346664 5:160320326-160320348 TTTCACAGAAGGAGAAACTGAGG - Intronic
1000386698 5:160681328-160681350 TTTCACAAAAGTGGAAACTGAGG + Intronic
1000551481 5:162670973-162670995 TTTCCCAGCAGAAAAACCTGGGG + Intergenic
1001010329 5:168091898-168091920 TTTCACAGCTGATGAAACTGAGG - Intronic
1001304097 5:170558938-170558960 TTTCACAGGTGAAGAAACTGAGG - Intronic
1001401142 5:171447152-171447174 TTTTACAGGAGAAGAAACTGAGG + Intronic
1001494155 5:172176156-172176178 TTTCACAGCTTAAGAAACTGAGG + Intronic
1001604507 5:172950401-172950423 TTTCACAGCGGAGGAAACTGAGG - Intronic
1001704073 5:173729188-173729210 TTTCACAGGTGAAGAATGTGAGG - Intergenic
1002130815 5:177080445-177080467 TTTCACAGAAGATGAAACTGAGG + Intronic
1002304490 5:178275139-178275161 TTTCACAAATGAGGAAACTGAGG - Intronic
1003134729 6:3425765-3425787 TTTCACAGATGAAGAAACTGAGG + Intronic
1003334004 6:5153550-5153572 TTTCACAAAAGAGGAAACTGAGG - Intronic
1003388896 6:5695290-5695312 TTACACAACAGCAGCATTTGTGG + Intronic
1004394718 6:15237563-15237585 TTTCACAAATGAAGAAAATGAGG + Intergenic
1004790438 6:19020704-19020726 TTCCACGTCAGAAGAACCTGTGG + Intergenic
1004795818 6:19083117-19083139 TTTTACATGAGTAGAATCTGTGG - Intergenic
1004836549 6:19538103-19538125 TTTCACAACACAGGCAGCTGAGG + Intergenic
1005755949 6:28924869-28924891 TTTCACACGAGGAGAAACTGAGG - Intergenic
1005971939 6:30768618-30768640 TTTCACAATTGAAGAAACTGAGG + Intergenic
1006192614 6:32218905-32218927 TTTTATAACTGAAGAAACTGAGG - Intronic
1006394846 6:33780580-33780602 TTTCACAGATGAAGAAACTGAGG - Intronic
1006501221 6:34460195-34460217 TTTTACAACTGAGGAAACTGAGG - Intergenic
1006755412 6:36410963-36410985 TTTTACAAATGAAGAAGCTGAGG - Intronic
1006901637 6:37506368-37506390 TTTCACAGATGAAGAAACTGAGG - Intergenic
1006942398 6:37761708-37761730 TTTCACAGCAGAGGAAACCGTGG - Intergenic
1007024576 6:38557460-38557482 TTTCACAAATGAGGAAACTGAGG - Intronic
1007048612 6:38802642-38802664 TTTCACAGCAGAGAAAACTGAGG - Intronic
1007201089 6:40109695-40109717 TTCCACTTCAGTAGAATCTGTGG + Intergenic
1007313875 6:40968802-40968824 TTTCACAGATGAAGAAACTGAGG + Intergenic
1007743251 6:44025617-44025639 TTTTATAGCAGAGGAATCTGAGG - Intergenic
1007760395 6:44129897-44129919 TTTTACAAATGAAGAAACTGAGG + Intronic
1007890917 6:45290846-45290868 TTTCACAAATGAGGAATCTGAGG + Intronic
1008053393 6:46922621-46922643 TTTTACAAAAGAGGAAACTGAGG + Intronic
1008363960 6:50653961-50653983 TTTTAAAACAGAAGACACTGGGG + Intergenic
1008426426 6:51363364-51363386 TTACACAAATGAAGAAACTGAGG - Intergenic
1008490323 6:52079616-52079638 TTTTACAAATGAACAATCTGAGG - Intronic
1008735648 6:54540460-54540482 TTTCACAACTGAAGAATCTGAGG - Intergenic
1008906873 6:56687460-56687482 TTTTACAAAAGAAGAAACTGAGG - Intronic
1009318683 6:62257065-62257087 TTTCACAAAAGAGGAAACTGAGG + Intronic
1009357639 6:62771269-62771291 TTTCACAAATGAAGAACGTGAGG + Intergenic
1010045151 6:71433125-71433147 TTTCACGAAAAAAAAATCTGTGG - Intergenic
1010393152 6:75359673-75359695 TCTCACAACAGAAAAAGTTGTGG + Intronic
1010397998 6:75414029-75414051 TTTTATAAATGAAGAATCTGAGG - Intronic
1011035237 6:82966731-82966753 TTTAACAAAAAAAGAATTTGTGG + Intronic
1011413466 6:87091402-87091424 TTTTAAAACAGAAAAACCTGAGG - Intronic
1011816341 6:91195425-91195447 TTTAACAGAAGAAGAAACTGTGG - Intergenic
1012429344 6:99147909-99147931 TTACAGAACACAAGAATGTGTGG + Intergenic
1012824455 6:104129296-104129318 TGTCAGAACATAAGATTCTGTGG - Intergenic
1013004283 6:106057115-106057137 TTTCACAACATAAGAATAAAAGG + Intergenic
1013282890 6:108655507-108655529 TTGCACATTAGAATAATCTGGGG + Intronic
1013683375 6:112550126-112550148 TTTTACAAGTGAAGAAACTGAGG - Intergenic
1013765505 6:113569919-113569941 TTTTAAAATAGAAGAATCTGAGG - Intergenic
1014406640 6:121060688-121060710 TTTTACACCGGAAGAAACTGAGG + Intergenic
1014564615 6:122932524-122932546 TTTCACAACAGAGGAATAGGGGG - Intergenic
1014572906 6:123032846-123032868 TTTCATACCTGAAGAAACTGAGG - Intronic
1014851654 6:126347098-126347120 TTTGACAACAGAAGCATCTGAGG - Intronic
1014919734 6:127199976-127199998 TTTTACAAAAGAGGAAACTGAGG + Intergenic
1015083429 6:129256270-129256292 ATTTACAAATGAAGAATCTGAGG - Intronic
1015283593 6:131459850-131459872 TTTCACAAATAAAGAAACTGAGG - Intergenic
1015345276 6:132149771-132149793 TTCCACAGAGGAAGAATCTGAGG - Intergenic
1015416908 6:132959518-132959540 TCTTACAACAGAAGACTGTGAGG - Intergenic
1015701772 6:136043493-136043515 TTTTACATAAGAAGAAACTGAGG - Intronic
1016100744 6:140097115-140097137 TTTGACAAATGAAGAAACTGAGG - Intergenic
1016117846 6:140310541-140310563 TTTTACAGGTGAAGAATCTGAGG - Intergenic
1016162906 6:140904135-140904157 AATCACAACAGTAAAATCTGTGG + Intergenic
1016428622 6:143959676-143959698 TTTCACAAATGAGGAAACTGAGG + Intronic
1016723553 6:147331919-147331941 TTTTACAGAAGAAGAAACTGAGG - Intronic
1016793915 6:148096946-148096968 TTTTACAAATGAAGAAGCTGGGG + Intergenic
1017128982 6:151091854-151091876 TTTTACAAGGGAAGAAACTGAGG - Intronic
1017903081 6:158734917-158734939 TTTCACAAATGAGGAACCTGAGG + Intronic
1019025664 6:168960802-168960824 TTTCACAAATGAGGAATCCGAGG - Intergenic
1019261255 7:83335-83357 TTTTACAACAGAAAATTATGGGG + Intergenic
1019279081 7:191386-191408 ATTCACATCAGAGGAAACTGAGG + Intergenic
1019312911 7:371472-371494 TTTCACAAGGGAGGAAACTGAGG - Intergenic
1019484799 7:1284569-1284591 TTTGACAACCAGAGAATCTGAGG - Intergenic
1019707676 7:2504311-2504333 TTTTACAGCTGAAGAAACTGAGG + Intergenic
1020406413 7:7840331-7840353 CTGCACATCAGAATAATCTGAGG + Intronic
1020508799 7:9026005-9026027 TTTCACAAGGGAGAAATCTGAGG - Intergenic
1020562373 7:9745665-9745687 TTTGTCAACAGAGAAATCTGAGG + Intergenic
1020627641 7:10601680-10601702 TTTCACCAAAGAAAAATTTGAGG + Intergenic
1021002205 7:15345376-15345398 TTTCACAACTGAAGGGTATGAGG - Intronic
1021068917 7:16212758-16212780 TTTTACAAATGAAGAACCTGGGG + Intronic
1021103835 7:16614695-16614717 TATTACGAAAGAAGAATCTGTGG - Intronic
1021164951 7:17326130-17326152 TTTTACAATAGAAGAAACTGAGG - Intronic
1021289250 7:18822810-18822832 TTTCACAAATGAAGAAATTGAGG - Intronic
1021464869 7:20930965-20930987 TTTCACAACAGAAAAACCGTTGG - Intergenic
1021596405 7:22321871-22321893 TTTAACACAAGAAGAACCTGTGG + Intronic
1021908270 7:25358137-25358159 TTTTACAAATGAAGAAACTGAGG + Intergenic
1021984841 7:26088532-26088554 TTTCACAGAAGAGGAAACTGAGG + Intergenic
1022227340 7:28376801-28376823 CTCCACAACAGAAGAAGCTGGGG + Intronic
1022711200 7:32852730-32852752 TTTTACAAATGAAGAAACTGAGG + Intergenic
1023057289 7:36300366-36300388 TTTCACAGCTGAAGACGCTGAGG + Exonic
1024098921 7:46008860-46008882 TTTTACAGAAGAAGAAACTGAGG - Intergenic
1024149730 7:46558795-46558817 TTTTACAACAGAGAAAGCTGAGG + Intergenic
1024155030 7:46613479-46613501 TTTAACAACAGAAAAAAATGAGG - Intergenic
1024263805 7:47591439-47591461 TTTCACAGAAGAAGAAACTGAGG - Intergenic
1024548849 7:50543727-50543749 TTTTACAACTGAGGAAACTGAGG - Intronic
1024682647 7:51708985-51709007 TGTCAGAACAGATGCATCTGTGG + Intergenic
1025253486 7:57367523-57367545 TTTTACAACAGTGGAAACTGAGG + Intergenic
1025274835 7:57570740-57570762 TTTCCCAAAAGAAGAGTTTGGGG + Intergenic
1026152141 7:67796829-67796851 TTTCCCCAAAGAAGAACCTGGGG - Intergenic
1026323116 7:69284642-69284664 TTTGACATCTGAAGAATCTGAGG + Intergenic
1026995079 7:74610455-74610477 TTTCACAAATGAAGAATCTGAGG + Intergenic
1027814792 7:82954526-82954548 TTTTTCAACAGAAGAAATTGAGG - Exonic
1028136147 7:87225072-87225094 TTTCACAAAAGTAAAAACTGAGG - Intergenic
1028635353 7:92982854-92982876 TTTAAGAACAGCAGTATCTGTGG - Intergenic
1028658921 7:93244492-93244514 TTTCACAAATGAAGAAACTGAGG - Intronic
1029616773 7:101664286-101664308 TTTCAAAACCAAAGAATTTGAGG - Intergenic
1030096305 7:105903250-105903272 TTTTACAAAGGAAGAAACTGAGG - Intronic
1030347288 7:108448871-108448893 TTGCACATCAAAACAATCTGTGG + Intronic
1030560826 7:111083647-111083669 TTTCACAGAAGAGGAAACTGGGG - Intronic
1030799731 7:113835074-113835096 CTTCACAGCTGAAGAAACTGAGG + Intergenic
1031229480 7:119086836-119086858 CTTCACAACAGAGGAAATTGAGG - Intergenic
1031936517 7:127740728-127740750 CTGCACATCAGAAGCATCTGAGG - Intronic
1031990103 7:128192047-128192069 TTTTACAGAAGAAGAAACTGAGG - Intergenic
1032374798 7:131402042-131402064 TTTCACAAAAGATTTATCTGTGG + Intronic
1032473454 7:132194979-132195001 TTTTACAAATGAAGAAACTGGGG + Intronic
1033671911 7:143501190-143501212 TTTTACATCAGAAGAAACTGAGG - Intergenic
1034159835 7:148985205-148985227 TTTTACAAATGAAGAAACTGAGG - Intergenic
1034677836 7:152904186-152904208 TTTTACAGGAGAAGAAACTGAGG - Intergenic
1034884723 7:154790592-154790614 TTACACAAATGAAGAAACTGAGG + Intronic
1035051195 7:155999823-155999845 TTTCTCAAGGGAAGAATCAGAGG + Intergenic
1035279497 7:157768605-157768627 TTTCTGAACAGAAACATCTGGGG - Intronic
1035536249 8:393503-393525 TTTTACAAAAGAGGAAACTGAGG - Intergenic
1035796246 8:2359839-2359861 TTTCACATCTGAGGAAACTGAGG + Intergenic
1036403121 8:8428222-8428244 TTTCACAGATGAAGAAACTGAGG + Intergenic
1036563559 8:9918777-9918799 TTTCACAGAAGAGGATTCTGAGG - Intergenic
1037766485 8:21775463-21775485 TTTCACAAGAGAGGGCTCTGAGG + Intronic
1037862077 8:22412444-22412466 TTTCACATCTGAAGAAACAGAGG - Intronic
1038078977 8:24110813-24110835 TTTCACAACAGAACAACCAAGGG + Intergenic
1038198459 8:25389692-25389714 TTTCACAGATGGAGAATCTGAGG - Intronic
1038350614 8:26773082-26773104 TTTTACAAATGAAGAAACTGTGG + Intronic
1038380219 8:27086068-27086090 TTTTCCAACAGAAATATCTGGGG + Intergenic
1038406755 8:27327793-27327815 TTTCAGAAAAGAGGATTCTGAGG - Intronic
1038654448 8:29436471-29436493 TTCTACAGCAGAAGAAACTGAGG + Intergenic
1038698093 8:29824230-29824252 TTTTAACACAGAAGAATCTCAGG - Intergenic
1039517727 8:38147466-38147488 TTCCACACCAGAAGAATGTGGGG + Intronic
1039997016 8:42542241-42542263 TTTTACAGGAGAAGAAACTGGGG - Intronic
1041232408 8:55767031-55767053 TTTTACAAATGAAGAAACTGAGG - Intronic
1041232411 8:55767133-55767155 TTTTACAAATGAAGAAACTGAGG - Intronic
1041282614 8:56226528-56226550 GTTCACCACAGGAGAAACTGGGG - Intergenic
1042176859 8:66045851-66045873 TTTCACAAAGGAAGACTCCGAGG - Intronic
1043305928 8:78795077-78795099 TTTCACAACAGAAGAATCTGAGG - Intronic
1043691502 8:83159058-83159080 TTTCACAAAGAAAGATTCTGAGG - Intergenic
1043815926 8:84801228-84801250 TTTCACCACAGAAGACACTTGGG + Intronic
1043955153 8:86351081-86351103 TTTTACAAAAGAAGAAACTGAGG - Intronic
1043987316 8:86708836-86708858 TTTCATAACAGTAGAAGCTGTGG + Intronic
1044020278 8:87097314-87097336 ATTTACAAAAGAAGAAACTGAGG + Intronic
1044137513 8:88605762-88605784 TTTCGCAACAGAAGATTCTTTGG - Intergenic
1044375592 8:91466493-91466515 TCTCAGAGCAGTAGAATCTGTGG + Intergenic
1044709746 8:95045124-95045146 TTTTACAAATGAAGAAACTGAGG - Intronic
1044823169 8:96172117-96172139 TTTCACTTCAAAAAAATCTGTGG - Intergenic
1045873554 8:106952607-106952629 TTTCATATCAGAATAATCTTGGG + Intergenic
1046524149 8:115362369-115362391 TTTCACAAGAGAGAAATCTGGGG + Intergenic
1046733208 8:117748167-117748189 TTTCACAACTGAAGAAATTGAGG - Intergenic
1046793877 8:118349536-118349558 TTAAACAATAGAAGAACCTGAGG - Intronic
1047127494 8:121978361-121978383 TTTTACAACAGAGAAATTTGAGG + Intergenic
1047177059 8:122551917-122551939 TTTCACAAGTGAGGAAACTGAGG + Intergenic
1047337249 8:123948197-123948219 TTTTACAAATGAAGAAACTGAGG + Intronic
1047514095 8:125538441-125538463 TTTTACAACTGAGGAAACTGAGG - Intergenic
1047521799 8:125600658-125600680 TTTCACAAATGGAGAAACTGAGG - Intergenic
1047595901 8:126377743-126377765 TTTCCTATCAGAATAATCTGGGG - Intergenic
1047796296 8:128259268-128259290 TTTGACAAATGAGGAATCTGAGG + Intergenic
1047882043 8:129205537-129205559 TTTCACAGATGAAGAAACTGAGG + Intergenic
1047955372 8:129970981-129971003 TTTTACAGGAGAAGAAACTGAGG - Intronic
1048859104 8:138710626-138710648 TTTCACAGATGAAGAAACTGAGG + Intronic
1049251454 8:141591295-141591317 TTTCACAGAAAAAGAAACTGAGG - Intergenic
1049341345 8:142114238-142114260 TTTCACAGCTGCAGAAACTGGGG + Intergenic
1049342638 8:142121360-142121382 TTTCACAAACGAGGAAGCTGCGG + Intergenic
1049930578 9:452465-452487 TTTTACAAAAGAGGAATCAGAGG + Intronic
1050075323 9:1856849-1856871 TTTTACAAGTGAAGAAACTGAGG - Intergenic
1050162150 9:2730209-2730231 TTTCACAGTTGAAGAAACTGAGG - Intronic
1050786639 9:9411938-9411960 TTTTACAAGTGAAGAAACTGAGG + Intronic
1051212575 9:14760131-14760153 TTTCACAAATGAAGAATCTAAGG + Intronic
1051307950 9:15736046-15736068 TTTTACAAGCGAGGAATCTGAGG + Intronic
1051348326 9:16172666-16172688 TTTCACAGTTGAAGAAACTGAGG + Intergenic
1051368477 9:16338256-16338278 TTTTACAAAAGTAGAAACTGAGG - Intergenic
1051507101 9:17839341-17839363 TTTGACCACAGAAGATGCTGAGG + Intergenic
1052245790 9:26332677-26332699 TTTTACAACTGCAGAATCTCAGG - Intergenic
1052641494 9:31172024-31172046 TTTCAAAGCATACGAATCTGTGG - Intergenic
1053413773 9:37933224-37933246 TTTCACAGATGAAGAAACTGAGG - Intronic
1054996748 9:71400000-71400022 TTTCTCACCTGAAGAAACTGAGG - Intronic
1056989283 9:91395048-91395070 TTTTACAAGTGAAGAAACTGAGG + Intergenic
1057695174 9:97318087-97318109 TTTTACAGAAGAAGAAACTGAGG + Intronic
1057768307 9:97943082-97943104 TTTTACAAGGGAAGAAACTGAGG - Intronic
1057801358 9:98192971-98192993 TTTCACAACGGGGGAAACTGAGG - Intergenic
1058031568 9:100204093-100204115 TTTCACAATTGAGGAAACTGAGG + Intronic
1058485982 9:105443924-105443946 TTTCACAGCTAAAGAAACTGAGG + Intergenic
1058514708 9:105758453-105758475 TTTCACAGCAGGAGAAGCAGTGG + Intronic
1058583767 9:106485399-106485421 TTTCTCATGAGAGGAATCTGGGG - Intergenic
1058655070 9:107212908-107212930 TTTCACAATTGAGGAAACTGAGG + Intergenic
1058755739 9:108081649-108081671 TTTTACATAAGAGGAATCTGAGG + Intergenic
1058941555 9:109817472-109817494 TTTCAGATCAAAAAAATCTGAGG - Intronic
1059186611 9:112278767-112278789 TTTTACAGGAGTAGAATCTGAGG - Intronic
1059460774 9:114428499-114428521 TTTCACTAGAGAGGAAACTGAGG + Intronic
1059577167 9:115502642-115502664 TTTCTGAACACAAGAATCTAAGG - Intergenic
1059646852 9:116276486-116276508 TTTCACAAAGGAAGAAACTGAGG - Intronic
1060037317 9:120266720-120266742 TTTAACAAATGAAGAAACTGAGG + Intergenic
1060150550 9:121285589-121285611 TTTTACAGCTGAGGAATCTGGGG + Intronic
1060155018 9:121313536-121313558 TTTTACAGAAGAGGAATCTGAGG - Intronic
1060205883 9:121682640-121682662 TTTCACAAAAGGGGAAACTGAGG - Intronic
1060591424 9:124819413-124819435 TTTCACAAATGAGGAAACTGAGG + Intergenic
1060666529 9:125435362-125435384 TTTAACAGAAGAAGAAACTGAGG + Intergenic
1060702281 9:125766394-125766416 TTTAAAAATAGAAAAATCTGTGG + Intronic
1060878086 9:127097896-127097918 TTTCACAGAAGAAGAAATTGAGG - Intronic
1061022648 9:128026252-128026274 TTTGATAGCAGAAGAAACTGAGG + Intergenic
1061049965 9:128189456-128189478 TTTTACAAATGAAGAAACTGAGG - Intronic
1061080044 9:128364612-128364634 TTTCACAGATGAGGAATCTGAGG + Intergenic
1061599766 9:131660228-131660250 TTTCATAACAAAAGAGTCTTTGG - Intronic
1061767052 9:132888087-132888109 TTTCACACCAGAATTACCTGGGG + Intronic
1061773551 9:132945416-132945438 TTTCACAGAGGAAGAAACTGAGG - Intergenic
1061984940 9:134125213-134125235 TTTTACAGCAGAGGAAACTGAGG + Intergenic
1062193596 9:135260279-135260301 TGTCACAGCAGAGGAAACTGAGG + Intergenic
1203626100 Un_KI270750v1:24599-24621 TTTCCCAAAAGAAGAGTTTGGGG + Intergenic
1185771655 X:2769411-2769433 TTTCCCAAAGGAAGAAACTGAGG - Intronic
1186028478 X:5340550-5340572 TTTCACAGAAGAGGAAACTGGGG - Intergenic
1186769091 X:12799961-12799983 TTTCACAACATTAGCATCAGAGG + Intronic
1186919947 X:14267860-14267882 TTTCACAGTTGAAGAAACTGAGG - Intergenic
1186921839 X:14290960-14290982 TTTCACAATTGAGGAAACTGAGG + Intergenic
1187390676 X:18884741-18884763 TTTCACAGAGGAAGAAACTGAGG + Intergenic
1187434792 X:19257850-19257872 GTTCTCACCAGAAGTATCTGGGG - Intergenic
1188170778 X:26922532-26922554 TCTCACAACAGAAAAGCCTGTGG - Intergenic
1188423533 X:30018038-30018060 TTTTACAAATGTAGAATCTGAGG + Intergenic
1188451483 X:30311582-30311604 TTTGACAAATGAAGAAACTGAGG - Intergenic
1188650142 X:32622265-32622287 TTTGAAAACAGAAGAACCTAAGG + Intronic
1188964952 X:36539558-36539580 TTTTACAAATAAAGAATCTGAGG + Intergenic
1189294347 X:39908312-39908334 TGTCACCACAGAGGAATCTGAGG - Intergenic
1190068809 X:47262309-47262331 TTCCACAACAGCACAATCTGAGG - Intergenic
1190745032 X:53317515-53317537 TTTTACAGCAGAAGAAACTGGGG - Intronic
1190898281 X:54642194-54642216 TTTTACAAGTGAAGAAACTGAGG + Intergenic
1191724942 X:64269421-64269443 TTTTACAAATGAAGAAACTGAGG + Intronic
1191790587 X:64968239-64968261 TTTCACACATGAAGAATTTGAGG + Intronic
1191921861 X:66265483-66265505 TTTTATAAAAGAAGAAACTGAGG + Intronic
1191963645 X:66731210-66731232 TTTCACAAATGAGGAAACTGAGG - Intergenic
1191970204 X:66805514-66805536 TTTCAAAACTGAAGATTCTGAGG + Intergenic
1192217156 X:69168132-69168154 TTCAAAAACAGAAGGATCTGAGG - Intergenic
1192935201 X:75851343-75851365 TCTCACAACTCAAGTATCTGTGG + Intergenic
1193041575 X:77009349-77009371 TTTCACAAATGAAGAATCTGAGG + Intergenic
1193180671 X:78452609-78452631 GGTAACAACAGAAAAATCTGAGG - Intergenic
1193576499 X:83204249-83204271 CATCAAAAAAGAAGAATCTGTGG - Intergenic
1194582304 X:95690518-95690540 TGGCACAGCAGAATAATCTGAGG - Intergenic
1194897004 X:99455213-99455235 TTTGACAACTGAAAAGTCTGGGG - Intergenic
1195134431 X:101890091-101890113 TTTTATACCAGAGGAATCTGCGG + Intronic
1195325229 X:103753001-103753023 TTTTATACCAGAGGAATCTGGGG - Intergenic
1195551774 X:106179840-106179862 TTTCCCAACATTAGAATCTGTGG - Intronic
1195698537 X:107684646-107684668 TTTTACAAATGAAGAAACTGAGG + Intergenic
1196121550 X:112056529-112056551 TTTTATAACTGAAGAAACTGAGG - Intronic
1196122635 X:112067176-112067198 TTTCATCACAGAAGACTTTGGGG + Intronic
1196732162 X:118951947-118951969 TTTCACAAGAGAAGAAGGTAAGG + Intergenic
1196917948 X:120558467-120558489 TTTTACAACCGAGGAAACTGAGG + Intronic
1197112044 X:122787845-122787867 TTTCACAAGTGAAGAAAGTGAGG + Intergenic
1197653643 X:129092182-129092204 TTTCCCAACAGAGAAATATGAGG - Intergenic
1197970259 X:132108109-132108131 TTTTACAACTGAGGAAACTGAGG - Intronic
1198184456 X:134239833-134239855 TTTTACACCTGAAGAATCTGAGG + Intronic
1198570189 X:137946644-137946666 TTTCACAATTGAGGAATCTGAGG + Intergenic
1198874918 X:141214114-141214136 TTTCACAAATGAAAAAACTGAGG + Intergenic
1198992271 X:142528338-142528360 TTTCACAAATGAGGAAGCTGAGG - Intergenic
1199165022 X:144662098-144662120 TTTCTCAACATAATAATCTGGGG - Intergenic
1199597055 X:149514402-149514424 TTTCCCGACAGAAGACTTTGCGG + Intronic
1199711376 X:150472036-150472058 TTTTACAAATGAAGAAACTGAGG + Intronic
1200294184 X:154901633-154901655 TTTTACAGCTGAAGAAACTGGGG + Intronic
1200374005 X:155760249-155760271 TTTTACAAATGAAGAAACTGAGG + Intergenic
1201983391 Y:19932279-19932301 TTTCACAACAAAATATTTTGAGG - Intergenic
1202046672 Y:20742697-20742719 TTTCAAAAGATAATAATCTGAGG - Intergenic