ID: 1043305933

View in Genome Browser
Species Human (GRCh38)
Location 8:78795118-78795140
Sequence CTTTCTCAAGGGCTGTTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043305927_1043305933 24 Left 1043305927 8:78795071-78795093 CCTGGGCCTCAGATTCTTCTGTT 0: 1
1: 0
2: 3
3: 55
4: 480
Right 1043305933 8:78795118-78795140 CTTTCTCAAGGGCTGTTGTAAGG No data
1043305926_1043305933 25 Left 1043305926 8:78795070-78795092 CCCTGGGCCTCAGATTCTTCTGT 0: 1
1: 0
2: 4
3: 74
4: 555
Right 1043305933 8:78795118-78795140 CTTTCTCAAGGGCTGTTGTAAGG No data
1043305928_1043305933 18 Left 1043305928 8:78795077-78795099 CCTCAGATTCTTCTGTTGTGAAA 0: 1
1: 1
2: 5
3: 99
4: 926
Right 1043305933 8:78795118-78795140 CTTTCTCAAGGGCTGTTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043305933 Original CRISPR CTTTCTCAAGGGCTGTTGTA AGG Intronic
No off target data available for this crispr